|
extractalign |
Wiki
The master copies of EMBOSS documentation are available at http://emboss.open-bio.org/wiki/Appdocs on the EMBOSS Wiki.Please help by correcting and extending the Wiki pages.
Function
Extract regions from a sequence alignmentDescription
extractalign allows you to specify one or more regions of a sequence alignment to extract sub-sequences from to build up a resulting sub-sequence alignment. extractalign reads in a sequence alignment and a set of regions of that alignment as specified by pairs of start and end positions (either on the command-line or contained in a file) using gapped alignment positions as the coordinates, and writes out the specified regions of the input sequence in the order in which they have been specified. Thus, if the sequence "AAAGGGTTT" has been input and the regions: "7-9, 3-4" have been specified, then the output sequence will be: "TTTAG".Usage
Here is a sample session with extractalignExtract the region from position 10 to 20:
% extractalign dna.msf result.seq -regions "11-30" Extract regions from a sequence alignment |
Go to the input files for this example
Go to the output files for this example
Command line arguments
Extract regions from a sequence alignment
Version: EMBOSS:6.6.0.0
Standard (Mandatory) qualifiers:
[-sequence] seqset (Aligned) sequence set filename and optional
format, or reference (input USA)
-regions range [Whole sequence] Regions to extract.
A set of regions is specified by a set of
pairs of positions.
The positions are integers.
They are separated by any non-digit,
non-alpha character.
Examples of region specifications are:
24-45, 56-78
1:45, 67=99;765..888
1,5,8,10,23,45,57,99
[-outseq] seqoutall [
|
| Qualifier | Type | Description | Allowed values | Default |
|---|---|---|---|---|
| Standard (Mandatory) qualifiers | ||||
| [-sequence] (Parameter 1) |
seqset | (Aligned) sequence set filename and optional format, or reference (input USA) | Readable set of sequences | Required |
| -regions | range | Regions to extract. A set of regions is specified by a set of pairs of positions. The positions are integers. They are separated by any non-digit, non-alpha character. Examples of region specifications are: 24-45, 56-78 1:45, 67=99;765..888 1,5,8,10,23,45,57,99 | Sequence range | Whole sequence |
| [-outseq] (Parameter 2) |
seqoutall | Sequence set(s) filename and optional format (output USA) | Writeable sequence(s) | <*>.format |
| Additional (Optional) qualifiers | ||||
| (none) | ||||
| Advanced (Unprompted) qualifiers | ||||
| (none) | ||||
| Associated qualifiers | ||||
| "-sequence" associated seqset qualifiers | ||||
| -sbegin1 -sbegin_sequence |
integer | Start of each sequence to be used | Any integer value | 0 |
| -send1 -send_sequence |
integer | End of each sequence to be used | Any integer value | 0 |
| -sreverse1 -sreverse_sequence |
boolean | Reverse (if DNA) | Boolean value Yes/No | N |
| -sask1 -sask_sequence |
boolean | Ask for begin/end/reverse | Boolean value Yes/No | N |
| -snucleotide1 -snucleotide_sequence |
boolean | Sequence is nucleotide | Boolean value Yes/No | N |
| -sprotein1 -sprotein_sequence |
boolean | Sequence is protein | Boolean value Yes/No | N |
| -slower1 -slower_sequence |
boolean | Make lower case | Boolean value Yes/No | N |
| -supper1 -supper_sequence |
boolean | Make upper case | Boolean value Yes/No | N |
| -scircular1 -scircular_sequence |
boolean | Sequence is circular | Boolean value Yes/No | N |
| -squick1 -squick_sequence |
boolean | Read id and sequence only | Boolean value Yes/No | N |
| -sformat1 -sformat_sequence |
string | Input sequence format | Any string | |
| -iquery1 -iquery_sequence |
string | Input query fields or ID list | Any string | |
| -ioffset1 -ioffset_sequence |
integer | Input start position offset | Any integer value | 0 |
| -sdbname1 -sdbname_sequence |
string | Database name | Any string | |
| -sid1 -sid_sequence |
string | Entryname | Any string | |
| -ufo1 -ufo_sequence |
string | UFO features | Any string | |
| -fformat1 -fformat_sequence |
string | Features format | Any string | |
| -fopenfile1 -fopenfile_sequence |
string | Features file name | Any string | |
| "-outseq" associated seqoutall qualifiers | ||||
| -osformat2 -osformat_outseq |
string | Output seq format | Any string | |
| -osextension2 -osextension_outseq |
string | File name extension | Any string | |
| -osname2 -osname_outseq |
string | Base file name | Any string | |
| -osdirectory2 -osdirectory_outseq |
string | Output directory | Any string | |
| -osdbname2 -osdbname_outseq |
string | Database name to add | Any string | |
| -ossingle2 -ossingle_outseq |
boolean | Separate file for each entry | Boolean value Yes/No | N |
| -oufo2 -oufo_outseq |
string | UFO features | Any string | |
| -offormat2 -offormat_outseq |
string | Features format | Any string | |
| -ofname2 -ofname_outseq |
string | Features file name | Any string | |
| -ofdirectory2 -ofdirectory_outseq |
string | Output directory | Any string | |
| General qualifiers | ||||
| -auto | boolean | Turn off prompts | Boolean value Yes/No | N |
| -stdout | boolean | Write first file to standard output | Boolean value Yes/No | N |
| -filter | boolean | Read first file from standard input, write first file to standard output | Boolean value Yes/No | N |
| -options | boolean | Prompt for standard and additional values | Boolean value Yes/No | N |
| -debug | boolean | Write debug output to program.dbg | Boolean value Yes/No | N |
| -verbose | boolean | Report some/full command line options | Boolean value Yes/No | Y |
| -help | boolean | Report command line options and exit. More information on associated and general qualifiers can be found with -help -verbose | Boolean value Yes/No | N |
| -warning | boolean | Report warnings | Boolean value Yes/No | Y |
| -error | boolean | Report errors | Boolean value Yes/No | Y |
| -fatal | boolean | Report fatal errors | Boolean value Yes/No | Y |
| -die | boolean | Report dying program messages | Boolean value Yes/No | Y |
| -version | boolean | Report version number and exit | Boolean value Yes/No | N |
Input file format
extractalign reads aligned nucleotide or protein sequences.
The input is a standard EMBOSS sequence query (also known as a 'USA').
Major sequence database sources defined as standard in EMBOSS installations include srs:embl, srs:uniprot and ensembl
Data can also be read from sequence output in any supported format written by an EMBOSS or third-party application.
The input format can be specified by using the command-line qualifier -sformat xxx, where 'xxx' is replaced by the name of the required format. The available format names are: gff (gff3), gff2, embl (em), genbank (gb, refseq), ddbj, refseqp, pir (nbrf), swissprot (swiss, sw), dasgff and debug.
See: http://emboss.sf.net/docs/themes/SequenceFormats.html for further information on sequence formats.
Input files for usage example
File: dna.msf
!!NA_MULTIPLE_ALIGNMENT
dna.msf MSF: 120 Type: N January 01, 1776 12:00 Check: 3196 ..
Name: MSFM1 Len: 120 Check: 8587 Weight: 1.00
Name: MSFM2 Len: 120 Check: 6178 Weight: 1.00
Name: MSFM3 Len: 120 Check: 8431 Weight: 1.00
//
MSFM1 ACGTACGTAC GTACGTACGT ACGTACGTAC GTACGTACGT ACGTACGTAC
MSFM2 ACGTACGTAC GTACGTACGT ....ACGTAC GTACGTACGT ACGTACGTAC
MSFM3 ACGTACGTAC GTACGTACGT ACGTACGTAC GTACGTACGT CGTACGTACG
MSFM1 GTACGTACGT ACGTACGTAC GTACGTACGT ACGTACGTAC GTACGTACGT
MSFM2 GTACGTACGT ACGTACGTAC GTACGTACGT ACGTACGTAC GTACGTACGT
MSFM3 TACGTACGTA CGTACGTACG TACGTACGTA ACGTACGTAC GTACGTACGT
MSFM1 ACGTACGTAC GTACGTACGT
MSFM2 ACGTACGTTG CAACGTACGT
MSFM3 ACGTACGTAC GTACGTACGT
|
You can specify a file of ranges to extract by giving the '-regions' qualifier the value '@' followed by the name of the file containing the ranges. (eg: '-regions @myfile').
The format of the range file is:
- Comment lines start with '#' in the first column.
- Comment lines and blank lines are ignored.
- The line may start with white-space.
- There are two positive (integer) numbers per line separated by one or more space or TAB characters.
- The second number must be greater or equal to the first number.
- There can be optional text after the two numbers to annotate the line.
- White-space before or after the text is removed.
An example range file is:
# this is my set of ranges 12 23 4 5 this is like 12-23, but smaller 67 10348 interesting region
Output file format
The output is a normal sequence file.Output files for usage example
File: result.seq
>MSFM1 GTACGTACGTACGTACGTAC >MSFM2 GTACGTACGT----ACGTAC >MSFM3 GTACGTACGTACGTACGTAC |
If the option '-separate' is used then each specified region is written to the output file as a separate sequence. The name of the sequence is created from the name of the original sequence with the start and end positions of the range appended with underscore characters between them,
For example: "XYZ region 2 to 34" is written as: "XYZ_2_34"
Data files
None.Notes
None.References
None.Warnings
None.Diagnostic Error Messages
Several warning messages about malformed region specifications:- Non-digit found in region ...
- Unpaired start of a region found in ...
- Non-digit found in region ...
- The start of a pair of region positions must be smaller than the end in ...
Exit status
It exits with status 0, unless a region is badly constructed.Known bugs
None noted.Comments
See also
| Program name | Description |
|---|---|
| abiview | Display the trace in an ABI sequencer file |
| aligncopy | Read and write alignments |
| aligncopypair | Read and write pairs from alignments |
| biosed | Replace or delete sequence sections |
| codcopy | Copy and reformat a codon usage table |
| coderet | Extract CDS, mRNA and translations from feature tables |
| cutseq | Remove a section from a sequence |
| degapseq | Remove non-alphabetic (e.g. gap) characters from sequences |
| descseq | Alter the name or description of a sequence |
| entret | Retrieve sequence entries from flatfile databases and files |
| extractfeat | Extract features from sequence(s) |
| extractseq | Extract regions from a sequence |
| featcopy | Read and write a feature table |
| featmerge | Merge two overlapping feature tables |
| featreport | Read and write a feature table |
| feattext | Return a feature table original text |
| infoalign | Display basic information about a multiple sequence alignment |
| infoseq | Display basic information about sequences |
| listor | Write a list file of the logical OR of two sets of sequences |
| makenucseq | Create random nucleotide sequences |
| makeprotseq | Create random protein sequences |
| maskambignuc | Mask all ambiguity characters in nucleotide sequences with N |
| maskambigprot | Mask all ambiguity characters in protein sequences with X |
| maskfeat | Write a sequence with masked features |
| maskseq | Write a sequence with masked regions |
| newseq | Create a sequence file from a typed-in sequence |
| nohtml | Remove mark-up (e.g. HTML tags) from an ASCII text file |
| noreturn | Remove carriage return from ASCII files |
| nospace | Remove whitespace from an ASCII text file |
| notab | Replace tabs with spaces in an ASCII text file |
| notseq | Write to file a subset of an input stream of sequences |
| nthseq | Write to file a single sequence from an input stream of sequences |
| nthseqset | Read and write (return) one set of sequences from many |
| pasteseq | Insert one sequence into another |
| refseqget | Get reference sequence |
| revseq | Reverse and complement a nucleotide sequence |
| seqcount | Read and count sequences |
| seqret | Read and write (return) sequences |
| seqretsetall | Read and write (return) many sets of sequences |
| seqretsplit | Read sequences and write them to individual files |
| seqxref | Retrieve all database cross-references for a sequence entry |
| seqxrefget | Retrieve all cross-referenced data for a sequence entry |
| showalign | Display a multiple sequence alignment in pretty format |
| sizeseq | Sort sequences by size |
| skipredundant | Remove redundant sequences from an input set |
| skipseq | Read and write (return) sequences, skipping first few |
| splitsource | Split sequence(s) into original source sequences |
| splitter | Split sequence(s) into smaller sequences |
| trimest | Remove poly-A tails from nucleotide sequences |
| trimseq | Remove unwanted characters from start and end of sequence(s) |
| trimspace | Remove extra whitespace from an ASCII text file |
| union | Concatenate multiple sequences into a single sequence |
| variationget | Get sequence variations |
| vectorstrip | Remove vectors from the ends of nucleotide sequence(s) |
| whichdb | Search all sequence databases for an entry and retrieve it |
| yank | Add a sequence reference (a full USA) to a list file |
Author(s)
Peter RiceEuropean Bioinformatics Institute, Wellcome Trust Genome Campus, Hinxton, Cambridge CB10 1SD, UK
Please report all bugs to the EMBOSS bug team (emboss-bug © emboss.open-bio.org) not to the original author.