nospace |
Please help by correcting and extending the Wiki pages.
% nospace Remove whitespace from an ASCII text file ASCII text file: seqspace.txt ASCII text output file [seqspace.nospace]: |
Go to the input files for this example
Go to the output files for this example
Remove whitespace from an ASCII text file Version: EMBOSS:6.6.0.0 Standard (Mandatory) qualifiers: [-infile] infile ASCII text file [-outfile] outfile [*.nospace] ASCII text output file Additional (Optional) qualifiers: -menu menu [all] Remove whitespace (Values: all (all whitespace); end (trailing whitespace); excess (multiple whitespace characters)) Advanced (Unprompted) qualifiers: (none) Associated qualifiers: "-outfile" associated qualifiers -odirectory2 string Output directory General qualifiers: -auto boolean Turn off prompts -stdout boolean Write first file to standard output -filter boolean Read first file from standard input, write first file to standard output -options boolean Prompt for standard and additional values -debug boolean Write debug output to program.dbg -verbose boolean Report some/full command line options -help boolean Report command line options and exit. More information on associated and general qualifiers can be found with -help -verbose -warning boolean Report warnings -error boolean Report errors -fatal boolean Report fatal errors -die boolean Report dying program messages -version boolean Report version number and exit |
Qualifier | Type | Description | Allowed values | Default | ||||||
---|---|---|---|---|---|---|---|---|---|---|
Standard (Mandatory) qualifiers | ||||||||||
[-infile] (Parameter 1) |
infile | ASCII text file | Input file | Required | ||||||
[-outfile] (Parameter 2) |
outfile | ASCII text output file | Output file | <*>.nospace | ||||||
Additional (Optional) qualifiers | ||||||||||
-menu | list | Remove whitespace |
|
all | ||||||
Advanced (Unprompted) qualifiers | ||||||||||
(none) | ||||||||||
Associated qualifiers | ||||||||||
"-outfile" associated outfile qualifiers | ||||||||||
-odirectory2 -odirectory_outfile |
string | Output directory | Any string | |||||||
General qualifiers | ||||||||||
-auto | boolean | Turn off prompts | Boolean value Yes/No | N | ||||||
-stdout | boolean | Write first file to standard output | Boolean value Yes/No | N | ||||||
-filter | boolean | Read first file from standard input, write first file to standard output | Boolean value Yes/No | N | ||||||
-options | boolean | Prompt for standard and additional values | Boolean value Yes/No | N | ||||||
-debug | boolean | Write debug output to program.dbg | Boolean value Yes/No | N | ||||||
-verbose | boolean | Report some/full command line options | Boolean value Yes/No | Y | ||||||
-help | boolean | Report command line options and exit. More information on associated and general qualifiers can be found with -help -verbose | Boolean value Yes/No | N | ||||||
-warning | boolean | Report warnings | Boolean value Yes/No | Y | ||||||
-error | boolean | Report errors | Boolean value Yes/No | Y | ||||||
-fatal | boolean | Report fatal errors | Boolean value Yes/No | Y | ||||||
-die | boolean | Report dying program messages | Boolean value Yes/No | Y | ||||||
-version | boolean | Report version number and exit | Boolean value Yes/No | N |
>X13776 ggtaccgctg gccgagcatc tgctcgatca ccaccagccg ggcgacggga actgcacgat ctacctggcg agcctggagc acgagcgggt tcgcttcgta cggcgctgag cgacagtcac aggagaggaa acggatggga tcgcaccagg agcggccgct gatcggcctg ctgttctccg aaaccggcgt caccgccgat atcgagcgct cgcacgcgta tggcgcattg ctcgcggtcg agcaactgaa ccgcgagggc ggcgtcggcg gtcgcccgat cgaaacgctg tcccaggacc ccggcggcga cccggaccgc tatcggctgt gcgccgagga cttcattcgc aaccgggggg tacggttcct cgtgggctgc tacatgtcgc acacgcgcaa ggcggtgatg ccggtggtcg agcgcgccga cgcgctgctc tgctacccga ccccctacga gggcttcgag tattcgccga acatcgtcta cggcggtccg gcgccgaacc agaacagtgc gccgctggcg gcgtacctga ttcgccacta cggcgagcgg gtggtgttca tcggctcgga ctacatctat ccgcgggaaa gcaaccatgt gatgcgccac ctgtatcgcc agcacggcgg cacggtgctc gaggaaatct acattccgct gtatccctcc gacgacgact tgcagcgcgc cgtcgagcgc atctaccagg cgcgcgccga cgtggtcttc tccaccgtgg tgggcaccgg caccgccgag ctgtatcgcg ccatcgcccg tcgctacggc gacggcaggc ggccgccgat cgccagcctg accaccagcg aggcggaggt ggcgaagatg gagagtgacg tggcagaggg gcaggtggtg gtcgcgcctt acttctccag catcgatacg cccgccagcc gggccttcgt ccaggcctgc catggtttct tcccggagaa cgcgaccatc accgcctggg ccgaggcggc ctactggcag accttgttgc tcggccgcgc cgcgcaggcc gcaggcaact ggcgggtgga agacgtgcag cggcacctgt acgacatcga catcgacgcg ccacaggggc cggtccgggt ggagcgccag aacaaccaca gccgcctgtc ttcgcgcatc gcggaaatcg atgcgcgcgg cgtgttccag gtccgctggc agtcgcccga accgattcgc cccgaccctt atgtcgtcgt gcataacctc gacgactggt ccgccagcat gggcggggga ccgctcccat gagcgccaac tcgctgctcg gcagcctgcg cgagttgcag gtgctggtcc tcaacccgcc gggggaggtc agcgacgccc tggtcttgca gctgatccgc atcggttgtt cggtgcgcca gtgctggccg ccgccggaag ccttcgacgt gccggtggac gtggtcttca ccagcatttt ccagaatggc caccacgacg agatcgctgc gctgctcgcc gccgggactc cgcgcactac cctggtggcg ctggtggagt acgaaagccc cgcggtgctc tcgcagatca tcgagctgga gtgccacggc gtgatcaccc agccgctcga tgcccaccgg gtgctgcctg tgctggtatc ggcgcggcgc atcagcgagg aaatggcgaa gctgaagcag aagaccgagc agctccagga ccgcatcgcc ggccaggccc ggatcaacca ggccaaggtg ttgctgatgc agcgccatgg ctgggacgag cgcgaggcgc accagcacct gtcgcgggaa gcgatgaagc ggcgcgagcc gatcctgaag atcgctcagg agttgctggg aaacgagccg tccgcctgag cgatccgggc cgaccagaac aataacaaga ggggtatcgt catcatgctg ggactggttc tgctgtacgt tggcgcggtg ctgtttctca atgccgtctg gttgctgggc aagatcagcg gtcgggaggt ggcggtgatc aacttcctgg tcggcgtgct gagcgcctgc gtcgcgttct acctgatctt ttccgcagca gccgggcagg gctcgctgaa ggccggagcg ctgaccctgc tattcgcttt tacctatctg tgggtggccg ccaaccagtt cctcgag |
>X13776 ggtaccgctggccgagcatctgctcgatcaccaccagccgggcgacggga actgcacgatctacctggcgagcctggagcacgagcgggttcgcttcgta cggcgctgagcgacagtcacaggagaggaaacggatgggatcgcaccagg agcggccgctgatcggcctgctgttctccgaaaccggcgtcaccgccgat atcgagcgctcgcacgcgtatggcgcattgctcgcggtcgagcaactgaa ccgcgagggcggcgtcggcggtcgcccgatcgaaacgctgtcccaggacc ccggcggcgacccggaccgctatcggctgtgcgccgaggacttcattcgc aaccggggggtacggttcctcgtgggctgctacatgtcgcacacgcgcaa ggcggtgatgccggtggtcgagcgcgccgacgcgctgctctgctacccga ccccctacgagggcttcgagtattcgccgaacatcgtctacggcggtccg gcgccgaaccagaacagtgcgccgctggcggcgtacctgattcgccacta cggcgagcgggtggtgttcatcggctcggactacatctatccgcgggaaa gcaaccatgtgatgcgccacctgtatcgccagcacggcggcacggtgctc gaggaaatctacattccgctgtatccctccgacgacgacttgcagcgcgc cgtcgagcgcatctaccaggcgcgcgccgacgtggtcttctccaccgtgg tgggcaccggcaccgccgagctgtatcgcgccatcgcccgtcgctacggc gacggcaggcggccgccgatcgccagcctgaccaccagcgaggcggaggt ggcgaagatggagagtgacgtggcagaggggcaggtggtggtcgcgcctt acttctccagcatcgatacgcccgccagccgggccttcgtccaggcctgc catggtttcttcccggagaacgcgaccatcaccgcctgggccgaggcggc ctactggcagaccttgttgctcggccgcgccgcgcaggccgcaggcaact ggcgggtggaagacgtgcagcggcacctgtacgacatcgacatcgacgcg ccacaggggccggtccgggtggagcgccagaacaaccacagccgcctgtc ttcgcgcatcgcggaaatcgatgcgcgcggcgtgttccaggtccgctggc agtcgcccgaaccgattcgccccgacccttatgtcgtcgtgcataacctc gacgactggtccgccagcatgggcgggggaccgctcccatgagcgccaac tcgctgctcggcagcctgcgcgagttgcaggtgctggtcctcaacccgcc gggggaggtcagcgacgccctggtcttgcagctgatccgcatcggttgtt cggtgcgccagtgctggccgccgccggaagccttcgacgtgccggtggac gtggtcttcaccagcattttccagaatggccaccacgacgagatcgctgc gctgctcgccgccgggactccgcgcactaccctggtggcgctggtggagt acgaaagccccgcggtgctctcgcagatcatcgagctggagtgccacggc gtgatcacccagccgctcgatgcccaccgggtgctgcctgtgctggtatc ggcgcggcgcatcagcgaggaaatggcgaagctgaagcagaagaccgagc agctccaggaccgcatcgccggccaggcccggatcaaccaggccaaggtg ttgctgatgcagcgccatggctgggacgagcgcgaggcgcaccagcacct gtcgcgggaagcgatgaagcggcgcgagccgatcctgaagatcgctcagg agttgctgggaaacgagccgtccgcctgagcgatccgggccgaccagaac aataacaagaggggtatcgtcatcatgctgggactggttctgctgtacgt tggcgcggtgctgtttctcaatgccgtctggttgctgggcaagatcagcg gtcgggaggtggcggtgatcaacttcctggtcggcgtgctgagcgcctgc gtcgcgttctacctgatcttttccgcagcagccgggcagggctcgctgaa ggccggagcgctgaccctgctattcgcttttacctatctgtgggtggccg ccaaccagttcctcgag |
Program name | Description |
---|---|
aligncopy | Read and write alignments |
aligncopypair | Read and write pairs from alignments |
biosed | Replace or delete sequence sections |
codcopy | Copy and reformat a codon usage table |
cutseq | Remove a section from a sequence |
degapseq | Remove non-alphabetic (e.g. gap) characters from sequences |
descseq | Alter the name or description of a sequence |
entret | Retrieve sequence entries from flatfile databases and files |
extractalign | Extract regions from a sequence alignment |
extractfeat | Extract features from sequence(s) |
extractseq | Extract regions from a sequence |
featcopy | Read and write a feature table |
featmerge | Merge two overlapping feature tables |
featreport | Read and write a feature table |
feattext | Return a feature table original text |
listor | Write a list file of the logical OR of two sets of sequences |
makenucseq | Create random nucleotide sequences |
makeprotseq | Create random protein sequences |
maskambignuc | Mask all ambiguity characters in nucleotide sequences with N |
maskambigprot | Mask all ambiguity characters in protein sequences with X |
maskfeat | Write a sequence with masked features |
maskseq | Write a sequence with masked regions |
newseq | Create a sequence file from a typed-in sequence |
nohtml | Remove mark-up (e.g. HTML tags) from an ASCII text file |
noreturn | Remove carriage return from ASCII files |
notab | Replace tabs with spaces in an ASCII text file |
notseq | Write to file a subset of an input stream of sequences |
nthseq | Write to file a single sequence from an input stream of sequences |
nthseqset | Read and write (return) one set of sequences from many |
pasteseq | Insert one sequence into another |
revseq | Reverse and complement a nucleotide sequence |
seqcount | Read and count sequences |
seqret | Read and write (return) sequences |
seqretsetall | Read and write (return) many sets of sequences |
seqretsplit | Read sequences and write them to individual files |
sizeseq | Sort sequences by size |
skipredundant | Remove redundant sequences from an input set |
skipseq | Read and write (return) sequences, skipping first few |
splitsource | Split sequence(s) into original source sequences |
splitter | Split sequence(s) into smaller sequences |
trimest | Remove poly-A tails from nucleotide sequences |
trimseq | Remove unwanted characters from start and end of sequence(s) |
trimspace | Remove extra whitespace from an ASCII text file |
union | Concatenate multiple sequences into a single sequence |
vectorstrip | Remove vectors from the ends of nucleotide sequence(s) |
yank | Add a sequence reference (a full USA) to a list file |
Please report all bugs to the EMBOSS bug team (emboss-bug © emboss.open-bio.org) not to the original author.