![]() |
seqretsplit |
Please help by correcting and extending the Wiki pages.
seqretsplit is a variant of the standard program for reading and writing sequences, seqret. It performs exactly the same function except that when it reads more than one sequence, it writes each sequence to an individual file. In all other respects, skipseq is the same as seqret. Its main use is therefore to split a file containing multiple sequences into many files, each containing one sequence. There are many options built-in into EMBOSS for detailed specification of the input and output sequences, for example the sequence type and file format. Optionally, feature information will be read and written.
% seqretsplit tembl:m1190* Read sequences and write them to individual files output sequence(s) [m11903.fasta]: |
Go to the input files for this example
Go to the output files for this example
The specification of the output file is not used in this case.
At some point this ought to change and you will not be prompted for the output file at all.
Read sequences and write them to individual files Version: EMBOSS:6.6.0.0 Standard (Mandatory) qualifiers: [-sequence] seqall (Gapped) sequence(s) filename and optional format, or reference (input USA) [-outseq] seqoutall [ |
Qualifier | Type | Description | Allowed values | Default |
---|---|---|---|---|
Standard (Mandatory) qualifiers | ||||
[-sequence] (Parameter 1) |
seqall | (Gapped) sequence(s) filename and optional format, or reference (input USA) | Readable sequence(s) | Required |
[-outseq] (Parameter 2) |
seqoutall | Sequence set(s) filename and optional format (output USA) | Writeable sequence(s) | <*>.format |
Additional (Optional) qualifiers | ||||
(none) | ||||
Advanced (Unprompted) qualifiers | ||||
-feature | boolean | Use feature information | Boolean value Yes/No | No |
-firstonly | boolean | Read one sequence and stop | Boolean value Yes/No | No |
Associated qualifiers | ||||
"-sequence" associated seqall qualifiers | ||||
-sbegin1 -sbegin_sequence |
integer | Start of each sequence to be used | Any integer value | 0 |
-send1 -send_sequence |
integer | End of each sequence to be used | Any integer value | 0 |
-sreverse1 -sreverse_sequence |
boolean | Reverse (if DNA) | Boolean value Yes/No | N |
-sask1 -sask_sequence |
boolean | Ask for begin/end/reverse | Boolean value Yes/No | N |
-snucleotide1 -snucleotide_sequence |
boolean | Sequence is nucleotide | Boolean value Yes/No | N |
-sprotein1 -sprotein_sequence |
boolean | Sequence is protein | Boolean value Yes/No | N |
-slower1 -slower_sequence |
boolean | Make lower case | Boolean value Yes/No | N |
-supper1 -supper_sequence |
boolean | Make upper case | Boolean value Yes/No | N |
-scircular1 -scircular_sequence |
boolean | Sequence is circular | Boolean value Yes/No | N |
-squick1 -squick_sequence |
boolean | Read id and sequence only | Boolean value Yes/No | N |
-sformat1 -sformat_sequence |
string | Input sequence format | Any string | |
-iquery1 -iquery_sequence |
string | Input query fields or ID list | Any string | |
-ioffset1 -ioffset_sequence |
integer | Input start position offset | Any integer value | 0 |
-sdbname1 -sdbname_sequence |
string | Database name | Any string | |
-sid1 -sid_sequence |
string | Entryname | Any string | |
-ufo1 -ufo_sequence |
string | UFO features | Any string | |
-fformat1 -fformat_sequence |
string | Features format | Any string | |
-fopenfile1 -fopenfile_sequence |
string | Features file name | Any string | |
"-outseq" associated seqoutall qualifiers | ||||
-osformat2 -osformat_outseq |
string | Output seq format | Any string | |
-osextension2 -osextension_outseq |
string | File name extension | Any string | |
-osname2 -osname_outseq |
string | Base file name | Any string | |
-osdirectory2 -osdirectory_outseq |
string | Output directory | Any string | |
-osdbname2 -osdbname_outseq |
string | Database name to add | Any string | |
-ossingle2 -ossingle_outseq |
boolean | Separate file for each entry | Boolean value Yes/No | Y |
-oufo2 -oufo_outseq |
string | UFO features | Any string | |
-offormat2 -offormat_outseq |
string | Features format | Any string | |
-ofname2 -ofname_outseq |
string | Features file name | Any string | |
-ofdirectory2 -ofdirectory_outseq |
string | Output directory | Any string | |
General qualifiers | ||||
-auto | boolean | Turn off prompts | Boolean value Yes/No | N |
-stdout | boolean | Write first file to standard output | Boolean value Yes/No | N |
-filter | boolean | Read first file from standard input, write first file to standard output | Boolean value Yes/No | N |
-options | boolean | Prompt for standard and additional values | Boolean value Yes/No | N |
-debug | boolean | Write debug output to program.dbg | Boolean value Yes/No | N |
-verbose | boolean | Report some/full command line options | Boolean value Yes/No | Y |
-help | boolean | Report command line options and exit. More information on associated and general qualifiers can be found with -help -verbose | Boolean value Yes/No | N |
-warning | boolean | Report warnings | Boolean value Yes/No | Y |
-error | boolean | Report errors | Boolean value Yes/No | Y |
-fatal | boolean | Report fatal errors | Boolean value Yes/No | Y |
-die | boolean | Report dying program messages | Boolean value Yes/No | Y |
-version | boolean | Report version number and exit | Boolean value Yes/No | N |
The input is a standard EMBOSS sequence query (also known as a 'USA').
Major sequence database sources defined as standard in EMBOSS installations include srs:embl, srs:uniprot and ensembl
Data can also be read from sequence output in any supported format written by an EMBOSS or third-party application.
The input format can be specified by using the command-line qualifier -sformat xxx, where 'xxx' is replaced by the name of the required format. The available format names are: gff (gff3), gff2, embl (em), genbank (gb, refseq), ddbj, refseqp, pir (nbrf), swissprot (swiss, sw), dasgff and debug.
See: http://emboss.sf.net/docs/themes/SequenceFormats.html for further information on sequence formats.
The output is a standard EMBOSS sequence file.
The results can be output in one of several styles by using the command-line qualifier -osformat xxx, where 'xxx' is replaced by the name of the required format. The available format names are: embl, genbank, gff, pir, swiss, dasgff, debug, listfile, dbmotif, diffseq, excel, feattable, motif, nametable, regions, seqtable, simple, srs, table, tagseq.
See: http://emboss.sf.net/docs/themes/SequenceFormats.html for further information on sequence formats.
>M11903 M11903.1 Rattus norvegicus androgen-responsive protein precursor (Svf) gene, exons 1 and 1A, alternatively spliced. cctttcaaatagaaactctcgtgaaggctgtctgagaacacaagctcaaggttgtgactg atttcagtgatgccgtcttgaagagggataccgtgctagagaatgactcctgatcaaccc tgaagacttctgcaagcccgaagtcgtgcttccccactctgaactgacatatgttcagga agtagagacgtgcaccgttggatgttctcaaggtaaaaaggaagatttggaagaatgctc tagtgttgttgccttggagaggaccagggaacagtacaagactcctactgagcagagaga aaggagcctgacatttaccgataagaaaggtcatttgccttccaacctgtaggcaaggcc agacaaggaaatatataaaggagaacctcagatcagctctcagtcaagacccttcctgac aagatgagtcccaccgggttcttcctccttacggtgctccttgttctggtgacagaagca gcctcgagggggccccgaggtgagtggcaattttgtgctatgggaaagatgtttgagaac tatgttctcaaaagggagtctgcagaatgctgtgttcccagggcttctccatgaaggaaa cttgagtcttttcaagctttaaccatagtcctactgtgagtctctgtgacttgacaagca acattgctggtaaggagggctgagggggaatgcgggcaacggcctcgggtaacatcctca ttgt |
>M11904 M11904.1 Rattus norvegicus androgen-responsive protein precursor (Svf) gene, exon 2 and complete cds. ggtatctccaaacacagcagctggctctcaacagagagtcctcatgcacaactaatccaa gatacagaaagtggatatagagaatgagacattgttttctctcaacagaaaaattctcac agtcagctgaagacccttatagtgaaaacatgaatctaaagattctggcgagcgggaggg gatcaagttctacctttggggcattcagccgaagtgagaactctcggagtaacttcaaat caaaaagtccaagcagtatcaccagggagaaagtgaatgaggaaagcaggagtgaaatga gtagtaccagcagccattttggtctcaaaatgagaagatctcatggaggaggagaaatga atccctttgaaaccaaagtaaagacccggatcactcgcaaataatgtgttccccggccaa ctgaagacttgagcccaataggcaggtaagtgttatcaccaggtgagggcttacaaacta ctcgtgcctaatccctaggccattgtaggattgtgcacgcagtaaagttgctataagggg aggtatggaaacgacctacaaggcagacaaagatacgagctatactgtgt |
>M11905 M11905.1 Rattus norvegicus androgen-responsive protein precursor (Svf) gene, exon 3. ccgtgcaatctcttcctgtgtccacacagccctgttagaagcaactctctcgttctcaag gccctacctgcaagaactacctttctcttcctccgcccaacaaaggaggaatgtttctgc ttgtgacccaccagagatgaaatatagcagtgtcctgcagtaaaggggggccccagaggc atgggacatacacgcattaatccctccacgtcttccctgtcctacctcacaggttgtcct cgttccctgggtgtcactgaactaagagaagtctatgatgtcttcaggatgcaggatccc acaggtgccccggaaatagtccgtgcttcttatttcctccttacacttgttttctttaag attccggaacctgacaagattcaaatttaaccttttcaataaaaaagatactattctgca tcattatctcctgaaatctcttgcttctgcagtacaggggctgggtgggattcctaaact tgaccagttctgccgttaaaggaagatcccttctgtgccgtatcagagactatttccaga ctctggataga |
One file for each input sequence is written out.
The names of the files it creates are derived from the ID name of the sequence, followed by an extension denoting the format of the sequence. You have no control over the names of the files it writes out.
For example, if the files embl:hsfa11* are read in and the output is specified as wibble.seq, then the following files are expected to be created:
hsfa110.fasta hsfa111.fasta hsfa112.fasta hsfa113.fasta hsfa114.fasta
(No file wibble.seq is created.)
See the documentation for seqret to see the full range of things that you can do when reading and writing sequences.
Some non-EMBOSS programs will accept only single sequences. In such cases seqretsplit is useful for splitting a multiple sequence file into many individual files. Some EMBOSS programs will also read only a single sequence, which may, however, be one of many in a file. You can specify the sequence using the USA filename:sequenceID. Nonetheless, some people feel more comfortable handling one sequence per file, so seqretsplit will be useful to them too.
One file for each input sequence is written. The names of the files it creates are derived from the ID name of the sequence, followed by an extension denoting the format of the sequence. You have no control over the names of the files it writes out. For example, if the files embl:hsfa11* are read in and the output is specified as wibble.seq, then the following files are expected to be created:
hsfa110.fasta hsfa111.fasta hsfa112.fasta hsfa113.fasta hsfa114.fasta
(No file wibble.seq is created.)
This is a side effect of the way sequence output works in EMBOSS. Writing multiple sequences to separate files (the -ossingle qualifier) does this, and seqretsplit has set it automatically on.
Program name | Description |
---|---|
aligncopy | Read and write alignments |
aligncopypair | Read and write pairs from alignments |
biosed | Replace or delete sequence sections |
codcopy | Copy and reformat a codon usage table |
cutseq | Remove a section from a sequence |
degapseq | Remove non-alphabetic (e.g. gap) characters from sequences |
descseq | Alter the name or description of a sequence |
entret | Retrieve sequence entries from flatfile databases and files |
extractalign | Extract regions from a sequence alignment |
extractfeat | Extract features from sequence(s) |
extractseq | Extract regions from a sequence |
featcopy | Read and write a feature table |
featmerge | Merge two overlapping feature tables |
featreport | Read and write a feature table |
feattext | Return a feature table original text |
listor | Write a list file of the logical OR of two sets of sequences |
makenucseq | Create random nucleotide sequences |
makeprotseq | Create random protein sequences |
maskambignuc | Mask all ambiguity characters in nucleotide sequences with N |
maskambigprot | Mask all ambiguity characters in protein sequences with X |
maskfeat | Write a sequence with masked features |
maskseq | Write a sequence with masked regions |
newseq | Create a sequence file from a typed-in sequence |
nohtml | Remove mark-up (e.g. HTML tags) from an ASCII text file |
noreturn | Remove carriage return from ASCII files |
nospace | Remove whitespace from an ASCII text file |
notab | Replace tabs with spaces in an ASCII text file |
notseq | Write to file a subset of an input stream of sequences |
nthseq | Write to file a single sequence from an input stream of sequences |
nthseqset | Read and write (return) one set of sequences from many |
pasteseq | Insert one sequence into another |
revseq | Reverse and complement a nucleotide sequence |
seqcount | Read and count sequences |
seqret | Read and write (return) sequences |
seqretsetall | Read and write (return) many sets of sequences |
sizeseq | Sort sequences by size |
skipredundant | Remove redundant sequences from an input set |
skipseq | Read and write (return) sequences, skipping first few |
splitsource | Split sequence(s) into original source sequences |
splitter | Split sequence(s) into smaller sequences |
trimest | Remove poly-A tails from nucleotide sequences |
trimseq | Remove unwanted characters from start and end of sequence(s) |
trimspace | Remove extra whitespace from an ASCII text file |
union | Concatenate multiple sequences into a single sequence |
vectorstrip | Remove vectors from the ends of nucleotide sequence(s) |
yank | Add a sequence reference (a full USA) to a list file |
Please report all bugs to the EMBOSS bug team (emboss-bug © emboss.open-bio.org) not to the original author.
At some point this ought to change and you will not be prompted for the output file at all.