![]() |
degapseq |
Please help by correcting and extending the Wiki pages.
degapseq reads one or more sequences and writes them out again but stripped of any non-alphabetic characters. It's main purpose is to remove gap characters from aligned sequences, but it will also remove such things as the symbol for translation STOP ('*') in a protein sequence.
% degapseq dnagap.fasta nogaps.seq Remove non-alphabetic (e.g. gap) characters from sequences |
Go to the input files for this example
Go to the output files for this example
Remove non-alphabetic (e.g. gap) characters from sequences Version: EMBOSS:6.6.0.0 Standard (Mandatory) qualifiers: [-sequence] seqall (Gapped) sequence(s) filename and optional format, or reference (input USA) [-outseq] seqoutall [ |
Qualifier | Type | Description | Allowed values | Default |
---|---|---|---|---|
Standard (Mandatory) qualifiers | ||||
[-sequence] (Parameter 1) |
seqall | (Gapped) sequence(s) filename and optional format, or reference (input USA) | Readable sequence(s) | Required |
[-outseq] (Parameter 2) |
seqoutall | Sequence set(s) filename and optional format (output USA) | Writeable sequence(s) | <*>.format |
Additional (Optional) qualifiers | ||||
(none) | ||||
Advanced (Unprompted) qualifiers | ||||
(none) | ||||
Associated qualifiers | ||||
"-sequence" associated seqall qualifiers | ||||
-sbegin1 -sbegin_sequence |
integer | Start of each sequence to be used | Any integer value | 0 |
-send1 -send_sequence |
integer | End of each sequence to be used | Any integer value | 0 |
-sreverse1 -sreverse_sequence |
boolean | Reverse (if DNA) | Boolean value Yes/No | N |
-sask1 -sask_sequence |
boolean | Ask for begin/end/reverse | Boolean value Yes/No | N |
-snucleotide1 -snucleotide_sequence |
boolean | Sequence is nucleotide | Boolean value Yes/No | N |
-sprotein1 -sprotein_sequence |
boolean | Sequence is protein | Boolean value Yes/No | N |
-slower1 -slower_sequence |
boolean | Make lower case | Boolean value Yes/No | N |
-supper1 -supper_sequence |
boolean | Make upper case | Boolean value Yes/No | N |
-scircular1 -scircular_sequence |
boolean | Sequence is circular | Boolean value Yes/No | N |
-squick1 -squick_sequence |
boolean | Read id and sequence only | Boolean value Yes/No | N |
-sformat1 -sformat_sequence |
string | Input sequence format | Any string | |
-iquery1 -iquery_sequence |
string | Input query fields or ID list | Any string | |
-ioffset1 -ioffset_sequence |
integer | Input start position offset | Any integer value | 0 |
-sdbname1 -sdbname_sequence |
string | Database name | Any string | |
-sid1 -sid_sequence |
string | Entryname | Any string | |
-ufo1 -ufo_sequence |
string | UFO features | Any string | |
-fformat1 -fformat_sequence |
string | Features format | Any string | |
-fopenfile1 -fopenfile_sequence |
string | Features file name | Any string | |
"-outseq" associated seqoutall qualifiers | ||||
-osformat2 -osformat_outseq |
string | Output seq format | Any string | |
-osextension2 -osextension_outseq |
string | File name extension | Any string | |
-osname2 -osname_outseq |
string | Base file name | Any string | |
-osdirectory2 -osdirectory_outseq |
string | Output directory | Any string | |
-osdbname2 -osdbname_outseq |
string | Database name to add | Any string | |
-ossingle2 -ossingle_outseq |
boolean | Separate file for each entry | Boolean value Yes/No | N |
-oufo2 -oufo_outseq |
string | UFO features | Any string | |
-offormat2 -offormat_outseq |
string | Features format | Any string | |
-ofname2 -ofname_outseq |
string | Features file name | Any string | |
-ofdirectory2 -ofdirectory_outseq |
string | Output directory | Any string | |
General qualifiers | ||||
-auto | boolean | Turn off prompts | Boolean value Yes/No | N |
-stdout | boolean | Write first file to standard output | Boolean value Yes/No | N |
-filter | boolean | Read first file from standard input, write first file to standard output | Boolean value Yes/No | N |
-options | boolean | Prompt for standard and additional values | Boolean value Yes/No | N |
-debug | boolean | Write debug output to program.dbg | Boolean value Yes/No | N |
-verbose | boolean | Report some/full command line options | Boolean value Yes/No | Y |
-help | boolean | Report command line options and exit. More information on associated and general qualifiers can be found with -help -verbose | Boolean value Yes/No | N |
-warning | boolean | Report warnings | Boolean value Yes/No | Y |
-error | boolean | Report errors | Boolean value Yes/No | Y |
-fatal | boolean | Report fatal errors | Boolean value Yes/No | Y |
-die | boolean | Report dying program messages | Boolean value Yes/No | Y |
-version | boolean | Report version number and exit | Boolean value Yes/No | N |
The input is a standard EMBOSS sequence query (also known as a 'USA').
Major sequence database sources defined as standard in EMBOSS installations include srs:embl, srs:uniprot and ensembl
Data can also be read from sequence output in any supported format written by an EMBOSS or third-party application.
The input format can be specified by using the command-line qualifier -sformat xxx, where 'xxx' is replaced by the name of the required format. The available format names are: gff (gff3), gff2, embl (em), genbank (gb, refseq), ddbj, refseqp, pir (nbrf), swissprot (swiss, sw), dasgff and debug.
See: http://emboss.sf.net/docs/themes/SequenceFormats.html for further information on sequence formats.
>FASTA F10002 FASTA FORMAT DNA SEQUENCE ACGT....ACGTACGTACGTACGTACGTACGTACGTACGT ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT ACGTACGTACGTACGTACGT |
>FASTA F10002 FASTA FORMAT DNA SEQUENCE ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT ACGTACGTACGTACGTACGTACGTACGTACGTACGT |
There are many different formats for storing molecular sequences in files. Some formats are specifically for aligned sequences, where gaps are inserted into the sequences for purposes of alignment. Gaps are indicated with different characters depending on the format in question, but commonly include '.', '-' and '~'. Some formats use more than one type of character to indicate different types of gaps, for example gaps at the sequence ends, internal gaps, gaps inserted by a program and gaps inserted manually by a person editing the alignment may all be denoted with different characters.
EMBOSS uses the dash character ('-') only to indicate gaps. When an EMBOSS program reads a sequence with gaps, all gap characters are changed internally to a dash ('-'). Thus any distinguishing characters for different gap types are convered to a '-' on output.
Program name | Description |
---|---|
aligncopy | Read and write alignments |
aligncopypair | Read and write pairs from alignments |
biosed | Replace or delete sequence sections |
codcopy | Copy and reformat a codon usage table |
cutseq | Remove a section from a sequence |
descseq | Alter the name or description of a sequence |
entret | Retrieve sequence entries from flatfile databases and files |
extractalign | Extract regions from a sequence alignment |
extractfeat | Extract features from sequence(s) |
extractseq | Extract regions from a sequence |
featcopy | Read and write a feature table |
featmerge | Merge two overlapping feature tables |
featreport | Read and write a feature table |
feattext | Return a feature table original text |
listor | Write a list file of the logical OR of two sets of sequences |
makenucseq | Create random nucleotide sequences |
makeprotseq | Create random protein sequences |
maskambignuc | Mask all ambiguity characters in nucleotide sequences with N |
maskambigprot | Mask all ambiguity characters in protein sequences with X |
maskfeat | Write a sequence with masked features |
maskseq | Write a sequence with masked regions |
newseq | Create a sequence file from a typed-in sequence |
nohtml | Remove mark-up (e.g. HTML tags) from an ASCII text file |
noreturn | Remove carriage return from ASCII files |
nospace | Remove whitespace from an ASCII text file |
notab | Replace tabs with spaces in an ASCII text file |
notseq | Write to file a subset of an input stream of sequences |
nthseq | Write to file a single sequence from an input stream of sequences |
nthseqset | Read and write (return) one set of sequences from many |
pasteseq | Insert one sequence into another |
revseq | Reverse and complement a nucleotide sequence |
seqcount | Read and count sequences |
seqret | Read and write (return) sequences |
seqretsetall | Read and write (return) many sets of sequences |
seqretsplit | Read sequences and write them to individual files |
sizeseq | Sort sequences by size |
skipredundant | Remove redundant sequences from an input set |
skipseq | Read and write (return) sequences, skipping first few |
splitsource | Split sequence(s) into original source sequences |
splitter | Split sequence(s) into smaller sequences |
trimest | Remove poly-A tails from nucleotide sequences |
trimseq | Remove unwanted characters from start and end of sequence(s) |
trimspace | Remove extra whitespace from an ASCII text file |
union | Concatenate multiple sequences into a single sequence |
vectorstrip | Remove vectors from the ends of nucleotide sequence(s) |
yank | Add a sequence reference (a full USA) to a list file |
Please report all bugs to the EMBOSS bug team (emboss-bug © emboss.open-bio.org) not to the original author.