|
featreport |
Wiki
The master copies of EMBOSS documentation are available at http://emboss.open-bio.org/wiki/Appdocs on the EMBOSS Wiki.Please help by correcting and extending the Wiki pages.
Function
Read and write a feature tableDescription
featreport reads a sequence and a feature table and writes a standard report output.Usage
Here is a sample session with featreport
% featreport Read and write a feature table Input sequence: paamir.fasta Input feature table: paamir.gff Output report [x13776.featreport]: test.out |
Go to the input files for this example
Go to the output files for this example
Command line arguments
Read and write a feature table
Version: EMBOSS:6.6.0.0
Standard (Mandatory) qualifiers:
[-sequence] sequence Sequence filename and optional format, or
reference (input USA)
[-features] features (no help text) features value
[-outfile] report [*.featreport] Output report file name
(default -rformat gff)
Additional (Optional) qualifiers: (none)
Advanced (Unprompted) qualifiers: (none)
Associated qualifiers:
"-sequence" associated qualifiers
-sbegin1 integer Start of the sequence to be used
-send1 integer End of the sequence to be used
-sreverse1 boolean Reverse (if DNA)
-sask1 boolean Ask for begin/end/reverse
-snucleotide1 boolean Sequence is nucleotide
-sprotein1 boolean Sequence is protein
-slower1 boolean Make lower case
-supper1 boolean Make upper case
-scircular1 boolean Sequence is circular
-squick1 boolean Read id and sequence only
-sformat1 string Input sequence format
-iquery1 string Input query fields or ID list
-ioffset1 integer Input start position offset
-sdbname1 string Database name
-sid1 string Entryname
-ufo1 string UFO features
-fformat1 string Features format
-fopenfile1 string Features file name
"-features" associated qualifiers
-fformat2 string Features format
-iquery2 string Input query fields or ID list
-ioffset2 integer Input start position offset
-fopenfile2 string Features file name
-fask2 boolean Prompt for begin/end/reverse
-fbegin2 integer Start of the features to be used
-fend2 integer End of the features to be used
-freverse2 boolean Reverse (if DNA)
-fcircular2 boolean Circular sequence features
"-outfile" associated qualifiers
-rformat3 string Report format
-rname3 string Base file name
-rextension3 string File name extension
-rdirectory3 string Output directory
-raccshow3 boolean Show accession number in the report
-rdesshow3 boolean Show description in the report
-rscoreshow3 boolean Show the score in the report
-rstrandshow3 boolean Show the nucleotide strand in the report
-rusashow3 boolean Show the full USA in the report
-rmaxall3 integer Maximum total hits to report
-rmaxseq3 integer Maximum hits to report for one sequence
General qualifiers:
-auto boolean Turn off prompts
-stdout boolean Write first file to standard output
-filter boolean Read first file from standard input, write
first file to standard output
-options boolean Prompt for standard and additional values
-debug boolean Write debug output to program.dbg
-verbose boolean Report some/full command line options
-help boolean Report command line options and exit. More
information on associated and general
qualifiers can be found with -help -verbose
-warning boolean Report warnings
-error boolean Report errors
-fatal boolean Report fatal errors
-die boolean Report dying program messages
-version boolean Report version number and exit
|
| Qualifier | Type | Description | Allowed values | Default |
|---|---|---|---|---|
| Standard (Mandatory) qualifiers | ||||
| [-sequence] (Parameter 1) |
sequence | Sequence filename and optional format, or reference (input USA) | Readable sequence | Required |
| [-features] (Parameter 2) |
features | (no help text) features value | Readable feature table | Required |
| [-outfile] (Parameter 3) |
report | Output report file name | (default -rformat gff) | <*>.featreport |
| Additional (Optional) qualifiers | ||||
| (none) | ||||
| Advanced (Unprompted) qualifiers | ||||
| (none) | ||||
| Associated qualifiers | ||||
| "-sequence" associated sequence qualifiers | ||||
| -sbegin1 -sbegin_sequence |
integer | Start of the sequence to be used | Any integer value | 0 |
| -send1 -send_sequence |
integer | End of the sequence to be used | Any integer value | 0 |
| -sreverse1 -sreverse_sequence |
boolean | Reverse (if DNA) | Boolean value Yes/No | N |
| -sask1 -sask_sequence |
boolean | Ask for begin/end/reverse | Boolean value Yes/No | N |
| -snucleotide1 -snucleotide_sequence |
boolean | Sequence is nucleotide | Boolean value Yes/No | N |
| -sprotein1 -sprotein_sequence |
boolean | Sequence is protein | Boolean value Yes/No | N |
| -slower1 -slower_sequence |
boolean | Make lower case | Boolean value Yes/No | N |
| -supper1 -supper_sequence |
boolean | Make upper case | Boolean value Yes/No | N |
| -scircular1 -scircular_sequence |
boolean | Sequence is circular | Boolean value Yes/No | N |
| -squick1 -squick_sequence |
boolean | Read id and sequence only | Boolean value Yes/No | N |
| -sformat1 -sformat_sequence |
string | Input sequence format | Any string | |
| -iquery1 -iquery_sequence |
string | Input query fields or ID list | Any string | |
| -ioffset1 -ioffset_sequence |
integer | Input start position offset | Any integer value | 0 |
| -sdbname1 -sdbname_sequence |
string | Database name | Any string | |
| -sid1 -sid_sequence |
string | Entryname | Any string | |
| -ufo1 -ufo_sequence |
string | UFO features | Any string | |
| -fformat1 -fformat_sequence |
string | Features format | Any string | |
| -fopenfile1 -fopenfile_sequence |
string | Features file name | Any string | |
| "-features" associated features qualifiers | ||||
| -fformat2 -fformat_features |
string | Features format | Any string | |
| -iquery2 -iquery_features |
string | Input query fields or ID list | Any string | |
| -ioffset2 -ioffset_features |
integer | Input start position offset | Any integer value | 0 |
| -fopenfile2 -fopenfile_features |
string | Features file name | Any string | |
| -fask2 -fask_features |
boolean | Prompt for begin/end/reverse | Boolean value Yes/No | N |
| -fbegin2 -fbegin_features |
integer | Start of the features to be used | Any integer value | 0 |
| -fend2 -fend_features |
integer | End of the features to be used | Any integer value | 0 |
| -freverse2 -freverse_features |
boolean | Reverse (if DNA) | Boolean value Yes/No | N |
| -fcircular2 -fcircular_features |
boolean | Circular sequence features | Boolean value Yes/No | N |
| "-outfile" associated report qualifiers | ||||
| -rformat3 -rformat_outfile |
string | Report format | Any string | gff |
| -rname3 -rname_outfile |
string | Base file name | Any string | |
| -rextension3 -rextension_outfile |
string | File name extension | Any string | |
| -rdirectory3 -rdirectory_outfile |
string | Output directory | Any string | |
| -raccshow3 -raccshow_outfile |
boolean | Show accession number in the report | Boolean value Yes/No | N |
| -rdesshow3 -rdesshow_outfile |
boolean | Show description in the report | Boolean value Yes/No | N |
| -rscoreshow3 -rscoreshow_outfile |
boolean | Show the score in the report | Boolean value Yes/No | Y |
| -rstrandshow3 -rstrandshow_outfile |
boolean | Show the nucleotide strand in the report | Boolean value Yes/No | Y |
| -rusashow3 -rusashow_outfile |
boolean | Show the full USA in the report | Boolean value Yes/No | N |
| -rmaxall3 -rmaxall_outfile |
integer | Maximum total hits to report | Any integer value | 0 |
| -rmaxseq3 -rmaxseq_outfile |
integer | Maximum hits to report for one sequence | Any integer value | 0 |
| General qualifiers | ||||
| -auto | boolean | Turn off prompts | Boolean value Yes/No | N |
| -stdout | boolean | Write first file to standard output | Boolean value Yes/No | N |
| -filter | boolean | Read first file from standard input, write first file to standard output | Boolean value Yes/No | N |
| -options | boolean | Prompt for standard and additional values | Boolean value Yes/No | N |
| -debug | boolean | Write debug output to program.dbg | Boolean value Yes/No | N |
| -verbose | boolean | Report some/full command line options | Boolean value Yes/No | Y |
| -help | boolean | Report command line options and exit. More information on associated and general qualifiers can be found with -help -verbose | Boolean value Yes/No | N |
| -warning | boolean | Report warnings | Boolean value Yes/No | Y |
| -error | boolean | Report errors | Boolean value Yes/No | Y |
| -fatal | boolean | Report fatal errors | Boolean value Yes/No | Y |
| -die | boolean | Report dying program messages | Boolean value Yes/No | Y |
| -version | boolean | Report version number and exit | Boolean value Yes/No | N |
Input file format
featreport reads any nucleotide or protein sequences with features.
The input is a standard EMBOSS sequence query (also known as a 'USA') with associated feature information.
Major sequence database sources defined as standard in EMBOSS installations include srs:embl, srs:uniprot and ensembl
Data can also be read from sequence output in any supported format written by an EMBOSS or third-party application.
The input format can be specified by using the command-line qualifier -sformat xxx, where 'xxx' is replaced by the name of the required format. The available format names are: text, html, xml (uniprotxml), obo, embl (swissprot)
Where the sequence format has no feature information, a second file can be read to load the feature data. The file is specified with the qualifier -ufo xxx and the feature format is specified with the qualifier -fformat xxx
See: http://emboss.sf.net/docs/themes/SequenceFormats.html for further information on sequence formats.
See: http://emboss.sf.net/docs/themes/FeatureFormats.html for further information on feature formats.
Input files for usage example
File: paamir.fasta
>X13776 X13776.1 Pseudomonas aeruginosa amiC and amiR gene for aliphatic amidase regulation ggtaccgctggccgagcatctgctcgatcaccaccagccgggcgacgggaactgcacgat ctacctggcgagcctggagcacgagcgggttcgcttcgtacggcgctgagcgacagtcac aggagaggaaacggatgggatcgcaccaggagcggccgctgatcggcctgctgttctccg aaaccggcgtcaccgccgatatcgagcgctcgcacgcgtatggcgcattgctcgcggtcg agcaactgaaccgcgagggcggcgtcggcggtcgcccgatcgaaacgctgtcccaggacc ccggcggcgacccggaccgctatcggctgtgcgccgaggacttcattcgcaaccgggggg tacggttcctcgtgggctgctacatgtcgcacacgcgcaaggcggtgatgccggtggtcg agcgcgccgacgcgctgctctgctacccgaccccctacgagggcttcgagtattcgccga acatcgtctacggcggtccggcgccgaaccagaacagtgcgccgctggcggcgtacctga ttcgccactacggcgagcgggtggtgttcatcggctcggactacatctatccgcgggaaa gcaaccatgtgatgcgccacctgtatcgccagcacggcggcacggtgctcgaggaaatct acattccgctgtatccctccgacgacgacttgcagcgcgccgtcgagcgcatctaccagg cgcgcgccgacgtggtcttctccaccgtggtgggcaccggcaccgccgagctgtatcgcg ccatcgcccgtcgctacggcgacggcaggcggccgccgatcgccagcctgaccaccagcg aggcggaggtggcgaagatggagagtgacgtggcagaggggcaggtggtggtcgcgcctt acttctccagcatcgatacgcccgccagccgggccttcgtccaggcctgccatggtttct tcccggagaacgcgaccatcaccgcctgggccgaggcggcctactggcagaccttgttgc tcggccgcgccgcgcaggccgcaggcaactggcgggtggaagacgtgcagcggcacctgt acgacatcgacatcgacgcgccacaggggccggtccgggtggagcgccagaacaaccaca gccgcctgtcttcgcgcatcgcggaaatcgatgcgcgcggcgtgttccaggtccgctggc agtcgcccgaaccgattcgccccgacccttatgtcgtcgtgcataacctcgacgactggt ccgccagcatgggcgggggaccgctcccatgagcgccaactcgctgctcggcagcctgcg cgagttgcaggtgctggtcctcaacccgccgggggaggtcagcgacgccctggtcttgca gctgatccgcatcggttgttcggtgcgccagtgctggccgccgccggaagccttcgacgt gccggtggacgtggtcttcaccagcattttccagaatggccaccacgacgagatcgctgc gctgctcgccgccgggactccgcgcactaccctggtggcgctggtggagtacgaaagccc cgcggtgctctcgcagatcatcgagctggagtgccacggcgtgatcacccagccgctcga tgcccaccgggtgctgcctgtgctggtatcggcgcggcgcatcagcgaggaaatggcgaa gctgaagcagaagaccgagcagctccaggaccgcatcgccggccaggcccggatcaacca ggccaaggtgttgctgatgcagcgccatggctgggacgagcgcgaggcgcaccagcacct gtcgcgggaagcgatgaagcggcgcgagccgatcctgaagatcgctcaggagttgctggg aaacgagccgtccgcctgagcgatccgggccgaccagaacaataacaagaggggtatcgt catcatgctgggactggttctgctgtacgttggcgcggtgctgtttctcaatgccgtctg gttgctgggcaagatcagcggtcgggaggtggcggtgatcaacttcctggtcggcgtgct gagcgcctgcgtcgcgttctacctgatcttttccgcagcagccgggcagggctcgctgaa ggccggagcgctgaccctgctattcgcttttacctatctgtgggtggccgccaaccagtt cctcgag |
File: paamir.gff
##gff-version 2.0 ##date 2003-02-14 ##Type DNA PAAMIR PAAMIR EMBL source 1 2167 0.000 + . Sequence "PAAMIR.1" ; db_xref "taxon:287" ; organism "Pseudomonas aeruginosa" ; strain "PAC" ; isolate "PAC 1" ; map "38 min" PAAMIR EMBL CDS 1289 1879 0.000 + . Sequence "PAAMIR.2" ; db_xref "SWISS-PROT:P10932" ; note "aliphatic amidase regulator, positive regulator of amiE" ; transl_table 11 ; gene "amiR" ; protein_id "CAA32023.1" ; translation "MSANSLLGSLRELQVLVLNPPGEVSDALVLQLIRIGCSVRQCWPPPEAFDVPVDVVFTSIFQNGHHDEIAALLAAGTPRTTLVALVEYESPAVLSQIIELECHGVITQPLDAHRVLPVLVSARRISEEMAKLKQKTEQLQDRIAGQARINQAKVLLMQRHGWDEREAHQHLSREAMKRREPILKIAQELLGNEPSA" PAAMIR EMBL CDS 135 1292 0.000 + . Sequence "PAAMIR.3" ; db_xref "SWISS-PROT:P27017" ; note "negative regulator of amiR" ; transl_table 11 ; gene "amiC" ; protein_id "CAA32024.1" ; translation "MGSHQERPLIGLLFSETGVTADIERSHAYGALLAVEQLNREGGVGGRPIETLSQDPGGDPDRYRLCAEDFIRNRGVRFLVGCYMSHTRKAVMPVVERADALLCYPTPYEGFEYSPNIVYGGPAPNQNSAPLAAYLIRHYGERVVFIGSDYIYPRESNHVMRHLYRQHGGTVLEEIYIPLYPSDDDLQRAVERIYQARADVVFSTVVGTGTAELYRAIARRYGDGRRPPIASLTTSEAEVAKMESDVAEGQVVVAPYFSSIDTPASRAFVQACHGFFPENATITAWAEAAYWQTLLLGRAAQAAGNWRVEDVQRHLYDIDIDAPQGPVRVERQNNHSRLSSRIAEIDARGVFQVRWQSPEPIRPDPYVVVHNLDDWSASMGGGPLP" PAAMIR EMBL promoter 8 24 0.000 + . Sequence "PAAMIR.4" ; note "proposed rpoN-dependent promoter" PAAMIR EMBL promoter 65 81 0.000 + . Sequence "PAAMIR.5" ; note "proposed rpoN-dependent promoter" PAAMIR EMBL RBS 121 126 0.000 + . Sequence "PAAMIR.6" ; note "proposed Shine-Dalgarno sequence" PAAMIR EMBL variation 912 1167 0.000 + . Sequence "PAAMIR.7" ; note "ClaI fragment deleted in pSW36, constitutive phenotype" ; replace "" ; gene "amiC" PAAMIR EMBL misc_feature 1 1 0.000 + . Sequence "PAAMIR.8" ; FeatFlags "0x40" ; note "last base of an XhoI site" PAAMIR EMBL misc_feature 648 653 0.000 + . Sequence "PAAMIR.9" ; note "end of 658bp XhoI fragment, deletion in pSW3 causes constitutive expression of amiE" PAAMIR EMBL conflict 1281 1281 0.000 + . Sequence "PAAMIR.10" ; FeatFlags "0x40" ; replace "g" ; citation [3] |
Output file format
The output is a standard EMBOSS report file.
The results can be output in one of several styles by using the command-line qualifier -rformat xxx, where 'xxx' is replaced by the name of the required format. The available format names are: embl, genbank, gff, pir, swiss, dasgff, debug, listfile, dbmotif, diffseq, draw, restrict, excel, feattable, motif, nametable, regions, seqtable, simple, srs, table, tagseq.
See: http://emboss.sf.net/docs/themes/ReportFormats.html for further information on report formats.
By default the report is in 'gff' feature format.
Output files for usage example
File: test.out
##gff-version 3 ##sequence-region PAAMIR 1 2167 #!Date 2013-07-15 #!Type DNA #!Source-version EMBOSS 6.6.0.0 PAAMIR EMBL databank_entry 1 2167 . + . ID=PAAMIR.1;db_xref=taxon:287;organism=Pseudomonas aeruginosa;strain=PAC;isolate=PAC 1;map=38 min PAAMIR EMBL CDS 1289 1879 . + 0 ID=PAAMIR.2;db_xref=SWISS-PROT:P10932;note=aliphatic amidase regulator%2C positive regulator of amiE;transl_table=11;gene=amiR;protein_id=CAA32023.1;translation=MSANSLLGSLRELQVLVLNPPGEVSDALVLQLIRIGCSVRQCWPPPEAFDVPVDVVFTSIFQNGHHDEIAALLAAGTPRTTLVALVEYESPAVLSQIIELECHGVITQPLDAHRVLPVLVSARRISEEMAKLKQKTEQLQDRIAGQARINQAKVLLMQRHGWDEREAHQHLSREAMKRREPILKIAQELLGNEPSA PAAMIR EMBL CDS 135 1292 . + 0 ID=PAAMIR.3;db_xref=SWISS-PROT:P27017;note=negative regulator of amiR;transl_table=11;gene=amiC;protein_id=CAA32024.1;translation=MGSHQERPLIGLLFSETGVTADIERSHAYGALLAVEQLNREGGVGGRPIETLSQDPGGDPDRYRLCAEDFIRNRGVRFLVGCYMSHTRKAVMPVVERADALLCYPTPYEGFEYSPNIVYGGPAPNQNSAPLAAYLIRHYGERVVFIGSDYIYPRESNHVMRHLYRQHGGTVLEEIYIPLYPSDDDLQRAVERIYQARADVVFSTVVGTGTAELYRAIARRYGDGRRPPIASLTTSEAEVAKMESDVAEGQVVVAPYFSSIDTPASRAFVQACHGFFPENATITAWAEAAYWQTLLLGRAAQAAGNWRVEDVQRHLYDIDIDAPQGPVRVERQNNHSRLSSRIAEIDARGVFQVRWQSPEPIRPDPYVVVHNLDDWSASMGGGPLP PAAMIR EMBL promoter 8 24 . + . ID=PAAMIR.4;note=proposed rpoN-dependent promoter PAAMIR EMBL promoter 65 81 . + . ID=PAAMIR.5;note=proposed rpoN-dependent promoter PAAMIR EMBL ribosome_entry_site 121 126 . + . ID=PAAMIR.6;note=proposed Shine-Dalgarno sequence PAAMIR EMBL sequence_variant 912 1167 . + . ID=PAAMIR.7;note=ClaI fragment deleted in pSW36%2C constitutive phenotype;replace=;gene=amiC PAAMIR EMBL sequence_feature 1 1 . + . ID=PAAMIR.8;note=last base of an XhoI site PAAMIR EMBL sequence_feature 648 653 . + . ID=PAAMIR.9;note=end of 658bp XhoI fragment%2C deletion in pSW3 causes constitutive expression of amiE PAAMIR EMBL sequence_conflict 1281 1281 . + . ID=PAAMIR.10;replace=g;citation=[3] |
Data files
None.Notes
None.References
None.Warnings
None.Diagnostic Error Messages
None.Exit status
It always exits with status 0.Known bugs
None.See also
| Program name | Description |
|---|---|
| aligncopy | Read and write alignments |
| aligncopypair | Read and write pairs from alignments |
| biosed | Replace or delete sequence sections |
| codcopy | Copy and reformat a codon usage table |
| cutseq | Remove a section from a sequence |
| degapseq | Remove non-alphabetic (e.g. gap) characters from sequences |
| descseq | Alter the name or description of a sequence |
| entret | Retrieve sequence entries from flatfile databases and files |
| extractalign | Extract regions from a sequence alignment |
| extractfeat | Extract features from sequence(s) |
| extractseq | Extract regions from a sequence |
| featcopy | Read and write a feature table |
| featmerge | Merge two overlapping feature tables |
| feattext | Return a feature table original text |
| listor | Write a list file of the logical OR of two sets of sequences |
| makenucseq | Create random nucleotide sequences |
| makeprotseq | Create random protein sequences |
| maskambignuc | Mask all ambiguity characters in nucleotide sequences with N |
| maskambigprot | Mask all ambiguity characters in protein sequences with X |
| maskfeat | Write a sequence with masked features |
| maskseq | Write a sequence with masked regions |
| newseq | Create a sequence file from a typed-in sequence |
| nohtml | Remove mark-up (e.g. HTML tags) from an ASCII text file |
| noreturn | Remove carriage return from ASCII files |
| nospace | Remove whitespace from an ASCII text file |
| notab | Replace tabs with spaces in an ASCII text file |
| notseq | Write to file a subset of an input stream of sequences |
| nthseq | Write to file a single sequence from an input stream of sequences |
| nthseqset | Read and write (return) one set of sequences from many |
| pasteseq | Insert one sequence into another |
| revseq | Reverse and complement a nucleotide sequence |
| seqcount | Read and count sequences |
| seqret | Read and write (return) sequences |
| seqretsetall | Read and write (return) many sets of sequences |
| seqretsplit | Read sequences and write them to individual files |
| sizeseq | Sort sequences by size |
| skipredundant | Remove redundant sequences from an input set |
| skipseq | Read and write (return) sequences, skipping first few |
| splitsource | Split sequence(s) into original source sequences |
| splitter | Split sequence(s) into smaller sequences |
| trimest | Remove poly-A tails from nucleotide sequences |
| trimseq | Remove unwanted characters from start and end of sequence(s) |
| trimspace | Remove extra whitespace from an ASCII text file |
| union | Concatenate multiple sequences into a single sequence |
| vectorstrip | Remove vectors from the ends of nucleotide sequence(s) |
| yank | Add a sequence reference (a full USA) to a list file |
Author(s)
Peter RiceEuropean Bioinformatics Institute, Wellcome Trust Genome Campus, Hinxton, Cambridge CB10 1SD, UK
Please report all bugs to the EMBOSS bug team (emboss-bug © emboss.open-bio.org) not to the original author.