![]() |
trimseq |
Please help by correcting and extending the Wiki pages.
trimseq reads one or more sequences and writes the same sequences out, but removing any regions at the start and / or end that contain unwanted characters. These include gap characters (where occur the sequences have been aligned), X's and N's (in nucleotide sequences), *'s (optionally) and (optionally) IUPAC ambiguity codes.
% trimseq untrimmed.seq trim1.seq -window 1 -percent 100 Remove unwanted characters from start and end of sequence(s) |
Go to the input files for this example
Go to the output files for this example
Example 2
% trimseq untrimmed.seq trim2.seq -window 5 -percent 40 Remove unwanted characters from start and end of sequence(s) |
Go to the output files for this example
Example 3
% trimseq untrimmed.seq trim3.seq -window 5 -percent 50 Remove unwanted characters from start and end of sequence(s) |
Go to the output files for this example
Example 4
% trimseq untrimmed.seq trim4.seq -window 5 -percent 50 -strict Remove unwanted characters from start and end of sequence(s) |
Go to the output files for this example
Example 5
% trimseq untrimmed.seq trim5.seq -window 5 -percent 50 -strict -noright Remove unwanted characters from start and end of sequence(s) |
Go to the output files for this example
Remove unwanted characters from start and end of sequence(s) Version: EMBOSS:6.6.0.0 Standard (Mandatory) qualifiers: [-sequence] seqall (Gapped) sequence(s) filename and optional format, or reference (input USA) [-outseq] seqoutall [ |
Qualifier | Type | Description | Allowed values | Default |
---|---|---|---|---|
Standard (Mandatory) qualifiers | ||||
[-sequence] (Parameter 1) |
seqall | (Gapped) sequence(s) filename and optional format, or reference (input USA) | Readable sequence(s) | Required |
[-outseq] (Parameter 2) |
seqoutall | Sequence set(s) filename and optional format (output USA) | Writeable sequence(s) | <*>.format |
Additional (Optional) qualifiers | ||||
-window | integer | This determines the size of the region that is considered when deciding whether the percentage of ambiguity is greater than the threshold. A value of 5 means that a region of 5 letters in the sequence is shifted along the sequence from the ends and trimming is done only if there is a greater or equal percentage of ambiguity than the threshold percentage. | Integer 1 or more | 1 |
-percent | float | This is the threshold of the percentage ambiguity in the window required in order to trim a sequence. | Any numeric value | 100.0 |
-strict | boolean | In nucleic sequences, trim off not only N's and X's, but also the nucleotide IUPAC ambiguity codes M, R, W, S, Y, K, V, H, D and B. In protein sequences, trim off not only X's but also B and Z. | Boolean value Yes/No | No |
-star | boolean | In protein sequences, trim off not only X's, but also the *'s | Boolean value Yes/No | No |
Advanced (Unprompted) qualifiers | ||||
-[no]left | boolean | Trim at the start | Boolean value Yes/No | Yes |
-[no]right | boolean | Trim at the end | Boolean value Yes/No | Yes |
Associated qualifiers | ||||
"-sequence" associated seqall qualifiers | ||||
-sbegin1 -sbegin_sequence |
integer | Start of each sequence to be used | Any integer value | 0 |
-send1 -send_sequence |
integer | End of each sequence to be used | Any integer value | 0 |
-sreverse1 -sreverse_sequence |
boolean | Reverse (if DNA) | Boolean value Yes/No | N |
-sask1 -sask_sequence |
boolean | Ask for begin/end/reverse | Boolean value Yes/No | N |
-snucleotide1 -snucleotide_sequence |
boolean | Sequence is nucleotide | Boolean value Yes/No | N |
-sprotein1 -sprotein_sequence |
boolean | Sequence is protein | Boolean value Yes/No | N |
-slower1 -slower_sequence |
boolean | Make lower case | Boolean value Yes/No | N |
-supper1 -supper_sequence |
boolean | Make upper case | Boolean value Yes/No | N |
-scircular1 -scircular_sequence |
boolean | Sequence is circular | Boolean value Yes/No | N |
-squick1 -squick_sequence |
boolean | Read id and sequence only | Boolean value Yes/No | N |
-sformat1 -sformat_sequence |
string | Input sequence format | Any string | |
-iquery1 -iquery_sequence |
string | Input query fields or ID list | Any string | |
-ioffset1 -ioffset_sequence |
integer | Input start position offset | Any integer value | 0 |
-sdbname1 -sdbname_sequence |
string | Database name | Any string | |
-sid1 -sid_sequence |
string | Entryname | Any string | |
-ufo1 -ufo_sequence |
string | UFO features | Any string | |
-fformat1 -fformat_sequence |
string | Features format | Any string | |
-fopenfile1 -fopenfile_sequence |
string | Features file name | Any string | |
"-outseq" associated seqoutall qualifiers | ||||
-osformat2 -osformat_outseq |
string | Output seq format | Any string | |
-osextension2 -osextension_outseq |
string | File name extension | Any string | |
-osname2 -osname_outseq |
string | Base file name | Any string | |
-osdirectory2 -osdirectory_outseq |
string | Output directory | Any string | |
-osdbname2 -osdbname_outseq |
string | Database name to add | Any string | |
-ossingle2 -ossingle_outseq |
boolean | Separate file for each entry | Boolean value Yes/No | N |
-oufo2 -oufo_outseq |
string | UFO features | Any string | |
-offormat2 -offormat_outseq |
string | Features format | Any string | |
-ofname2 -ofname_outseq |
string | Features file name | Any string | |
-ofdirectory2 -ofdirectory_outseq |
string | Output directory | Any string | |
General qualifiers | ||||
-auto | boolean | Turn off prompts | Boolean value Yes/No | N |
-stdout | boolean | Write first file to standard output | Boolean value Yes/No | N |
-filter | boolean | Read first file from standard input, write first file to standard output | Boolean value Yes/No | N |
-options | boolean | Prompt for standard and additional values | Boolean value Yes/No | N |
-debug | boolean | Write debug output to program.dbg | Boolean value Yes/No | N |
-verbose | boolean | Report some/full command line options | Boolean value Yes/No | Y |
-help | boolean | Report command line options and exit. More information on associated and general qualifiers can be found with -help -verbose | Boolean value Yes/No | N |
-warning | boolean | Report warnings | Boolean value Yes/No | Y |
-error | boolean | Report errors | Boolean value Yes/No | Y |
-fatal | boolean | Report fatal errors | Boolean value Yes/No | Y |
-die | boolean | Report dying program messages | Boolean value Yes/No | Y |
-version | boolean | Report version number and exit | Boolean value Yes/No | N |
>myseq ...ttyyyctttctcgactccatcttcgcggtagctgggaccgccgttcagtcgccaatatgc agctctttgtccgcgcccaggagctacacaccttcgaggtgaccggccaggaaacggtcg cccagatcaaggctcatgtagcctcactggagggcattgccccggaagatcaagtcgtgc tcctggcaggcgcgcccctggaggatgaggccactctgggccagtgcggggtggaggccc tgactaccctggaagtagcaggccgcatgcttggaggtaaagttcatggttccctggccc gtgctggaaaagtgagaggtcagactcctaaggtggccaaacaggagaagaagaagaaga agacaggtcgggctaagcggcggatgcagtacaaccggcgctttgtcaacgttgtgccca cctttggcaagaagaagggccccaatgccaactcttaagtcttttgtaattctggctttc tctaataaaaaagccacttagttca.gnntcynnnnnn |
>myseq ttyyyctttctcgactccatcttcgcggtagctgggaccgccgttcagtcgccaatatgc agctctttgtccgcgcccaggagctacacaccttcgaggtgaccggccaggaaacggtcg cccagatcaaggctcatgtagcctcactggagggcattgccccggaagatcaagtcgtgc tcctggcaggcgcgcccctggaggatgaggccactctgggccagtgcggggtggaggccc tgactaccctggaagtagcaggccgcatgcttggaggtaaagttcatggttccctggccc gtgctggaaaagtgagaggtcagactcctaaggtggccaaacaggagaagaagaagaaga agacaggtcgggctaagcggcggatgcagtacaaccggcgctttgtcaacgttgtgccca cctttggcaagaagaagggccccaatgccaactcttaagtcttttgtaattctggctttc tctaataaaaaagccacttagttca-gnntcy |
>myseq ttyyyctttctcgactccatcttcgcggtagctgggaccgccgttcagtcgccaatatgc agctctttgtccgcgcccaggagctacacaccttcgaggtgaccggccaggaaacggtcg cccagatcaaggctcatgtagcctcactggagggcattgccccggaagatcaagtcgtgc tcctggcaggcgcgcccctggaggatgaggccactctgggccagtgcggggtggaggccc tgactaccctggaagtagcaggccgcatgcttggaggtaaagttcatggttccctggccc gtgctggaaaagtgagaggtcagactcctaaggtggccaaacaggagaagaagaagaaga agacaggtcgggctaagcggcggatgcagtacaaccggcgctttgtcaacgttgtgccca cctttggcaagaagaagggccccaatgccaactcttaagtcttttgtaattctggctttc tctaataaaaaagccacttagttca-g |
>myseq ttyyyctttctcgactccatcttcgcggtagctgggaccgccgttcagtcgccaatatgc agctctttgtccgcgcccaggagctacacaccttcgaggtgaccggccaggaaacggtcg cccagatcaaggctcatgtagcctcactggagggcattgccccggaagatcaagtcgtgc tcctggcaggcgcgcccctggaggatgaggccactctgggccagtgcggggtggaggccc tgactaccctggaagtagcaggccgcatgcttggaggtaaagttcatggttccctggccc gtgctggaaaagtgagaggtcagactcctaaggtggccaaacaggagaagaagaagaaga agacaggtcgggctaagcggcggatgcagtacaaccggcgctttgtcaacgttgtgccca cctttggcaagaagaagggccccaatgccaactcttaagtcttttgtaattctggctttc tctaataaaaaagccacttagttca-gnntcy |
>myseq ctttctcgactccatcttcgcggtagctgggaccgccgttcagtcgccaatatgcagctc tttgtccgcgcccaggagctacacaccttcgaggtgaccggccaggaaacggtcgcccag atcaaggctcatgtagcctcactggagggcattgccccggaagatcaagtcgtgctcctg gcaggcgcgcccctggaggatgaggccactctgggccagtgcggggtggaggccctgact accctggaagtagcaggccgcatgcttggaggtaaagttcatggttccctggcccgtgct ggaaaagtgagaggtcagactcctaaggtggccaaacaggagaagaagaagaagaagaca ggtcgggctaagcggcggatgcagtacaaccggcgctttgtcaacgttgtgcccaccttt ggcaagaagaagggccccaatgccaactcttaagtcttttgtaattctggctttctctaa taaaaaagccacttagttca-gnntc |
>myseq ctttctcgactccatcttcgcggtagctgggaccgccgttcagtcgccaatatgcagctc tttgtccgcgcccaggagctacacaccttcgaggtgaccggccaggaaacggtcgcccag atcaaggctcatgtagcctcactggagggcattgccccggaagatcaagtcgtgctcctg gcaggcgcgcccctggaggatgaggccactctgggccagtgcggggtggaggccctgact accctggaagtagcaggccgcatgcttggaggtaaagttcatggttccctggcccgtgct ggaaaagtgagaggtcagactcctaaggtggccaaacaggagaagaagaagaagaagaca ggtcgggctaagcggcggatgcagtacaaccggcgctttgtcaacgttgtgcccaccttt ggcaagaagaagggccccaatgccaactcttaagtcttttgtaattctggctttctctaa taaaaaagccacttagttca-gnntcynnnnnn |
trimseq will remove from a terminal region:
Rather than removing individual characters, it removes an entire segment, using a threshold percentage of unwanted characters in a window of a specified size which is moved along the sequence from the ends. The program stops trimming when the percentage of unwanted characters in the moving window drops below the specified threshold percentage.
Thus if the window size is set to 1 and the percentage threshold is 100, no further poor quality regions will be removed. If the window size is set to 5 and the percentage threshold is 40 then the sequence AAGCTNNNNATT will be trimmed to AAGCT, while AAGCTNATT or AAGCTNNNNATTT will not be trimmed as less than 40% of the last 5 characters are N's.
After trimming these poor quality regions, it will again then trim off any dangling gap characters from the ends.
Program name | Description |
---|---|
aligncopy | Read and write alignments |
aligncopypair | Read and write pairs from alignments |
biosed | Replace or delete sequence sections |
codcopy | Copy and reformat a codon usage table |
cutseq | Remove a section from a sequence |
degapseq | Remove non-alphabetic (e.g. gap) characters from sequences |
descseq | Alter the name or description of a sequence |
entret | Retrieve sequence entries from flatfile databases and files |
extractalign | Extract regions from a sequence alignment |
extractfeat | Extract features from sequence(s) |
extractseq | Extract regions from a sequence |
featcopy | Read and write a feature table |
featmerge | Merge two overlapping feature tables |
featreport | Read and write a feature table |
feattext | Return a feature table original text |
listor | Write a list file of the logical OR of two sets of sequences |
makenucseq | Create random nucleotide sequences |
makeprotseq | Create random protein sequences |
maskambignuc | Mask all ambiguity characters in nucleotide sequences with N |
maskambigprot | Mask all ambiguity characters in protein sequences with X |
maskfeat | Write a sequence with masked features |
maskseq | Write a sequence with masked regions |
newseq | Create a sequence file from a typed-in sequence |
nohtml | Remove mark-up (e.g. HTML tags) from an ASCII text file |
noreturn | Remove carriage return from ASCII files |
nospace | Remove whitespace from an ASCII text file |
notab | Replace tabs with spaces in an ASCII text file |
notseq | Write to file a subset of an input stream of sequences |
nthseq | Write to file a single sequence from an input stream of sequences |
nthseqset | Read and write (return) one set of sequences from many |
pasteseq | Insert one sequence into another |
revseq | Reverse and complement a nucleotide sequence |
seqcount | Read and count sequences |
seqret | Read and write (return) sequences |
seqretsetall | Read and write (return) many sets of sequences |
seqretsplit | Read sequences and write them to individual files |
sizeseq | Sort sequences by size |
skipredundant | Remove redundant sequences from an input set |
skipseq | Read and write (return) sequences, skipping first few |
splitsource | Split sequence(s) into original source sequences |
splitter | Split sequence(s) into smaller sequences |
trimest | Remove poly-A tails from nucleotide sequences |
trimspace | Remove extra whitespace from an ASCII text file |
union | Concatenate multiple sequences into a single sequence |
vectorstrip | Remove vectors from the ends of nucleotide sequence(s) |
yank | Add a sequence reference (a full USA) to a list file |
Please report all bugs to the EMBOSS bug team (emboss-bug © emboss.open-bio.org) not to the original author.