abiview

 

Wiki

The master copies of EMBOSS documentation are available at http://emboss.open-bio.org/wiki/Appdocs on the EMBOSS Wiki.

Please help by correcting and extending the Wiki pages.

Function

Display the trace in an ABI sequencer file

Description

abiview reads in an ABI sequencer trace file and graphically displays the data. The probabilities of each of the 4 nucleotide bases along the sequencing run is plotted and the assigned nucleotide (G, A, T, C or N) from the ABI file is overlayed on the graphs. The complete sequence is written to an output file.

Usage

Here is a sample session with abiview 


% abiview -graph cps 
Display the trace in an ABI sequencer file
ABI sequencing trace file: abiview.abi
nucleotide output sequence [abiview.fasta]: 

Created abiview.ps

Go to the input files for this example
Go to the output files for this example

Command line arguments 

Display the trace in an ABI sequencer file
Version: EMBOSS:6.6.0.0

   Standard (Mandatory) qualifiers:
  [-infile]            infile     ABI sequencing trace file
  [-outseq]            seqout     [.] Nucleotide sequence
                                  filename and optional format (output USA)
   -graph              xygraph    [$EMBOSS_GRAPHICS value, or x11] Graph type
                                  (ps, hpgl, hp7470, hp7580, meta, cps, x11,
                                  tek, tekt, none, data, xterm, png, gif, pdf,
                                  svg)

   Additional (Optional) qualifiers:
   -startbase          integer    [0] First base to report or display (Integer
                                  0 or more)
   -endbase            integer    [0] Last sequence base to report or display.
                                  If the default is set to zero then the
                                  value of this is taken as the maximum number
                                  of bases. (Any integer value)
   -yticks             boolean    [N] Display y-axis ticks
   -[no]sequence       boolean    [Y] Display the sequence on the graph
   -window             integer    [40] Sequence display window size (Any
                                  integer value)
   -bases              string     [GATC] Base graphs to be displayed (Any
                                  string, matching regular expression
                                  /[GATC]+/)

   Advanced (Unprompted) qualifiers:
   -separate           boolean    [N] Separate the trace graphs for the 4
                                  bases

   Associated qualifiers:

   "-outseq" associated qualifiers
   -osformat2          string     Output seq format
   -osextension2       string     File name extension
   -osname2            string     Base file name
   -osdirectory2       string     Output directory
   -osdbname2          string     Database name to add
   -ossingle2          boolean    Separate file for each entry
   -oufo2              string     UFO features
   -offormat2          string     Features format
   -ofname2            string     Features file name
   -ofdirectory2       string     Output directory

   "-graph" associated qualifiers
   -gprompt            boolean    Graph prompting
   -gdesc              string     Graph description
   -gtitle             string     Graph title
   -gsubtitle          string     Graph subtitle
   -gxtitle            string     Graph x axis title
   -gytitle            string     Graph y axis title
   -goutfile           string     Output file for non interactive displays
   -gdirectory         string     Output directory

   General qualifiers:
   -auto               boolean    Turn off prompts
   -stdout             boolean    Write first file to standard output
   -filter             boolean    Read first file from standard input, write
                                  first file to standard output
   -options            boolean    Prompt for standard and additional values
   -debug              boolean    Write debug output to program.dbg
   -verbose            boolean    Report some/full command line options
   -help               boolean    Report command line options and exit. More
                                  information on associated and general
                                  qualifiers can be found with -help -verbose
   -warning            boolean    Report warnings
   -error              boolean    Report errors
   -fatal              boolean    Report fatal errors
   -die                boolean    Report dying program messages
   -version            boolean    Report version number and exit

Qualifier Type Description Allowed values Default
Standard (Mandatory) qualifiers
[-infile]
(Parameter 1)		 infile ABI sequencing trace file Input file Required
[-outseq]
(Parameter 2)		 seqout Nucleotide sequence filename and optional format (output USA) Writeable sequence <*>.format
-graph xygraph Graph type EMBOSS has a list of known devices, including ps, hpgl, hp7470, hp7580, meta, cps, x11, tek, tekt, none, data, xterm, png, gif, pdf, svg EMBOSS_GRAPHICS value, or x11
Additional (Optional) qualifiers
-startbase integer First base to report or display Integer 0 or more 0
-endbase integer Last sequence base to report or display. If the default is set to zero then the value of this is taken as the maximum number of bases. Any integer value 0
-yticks boolean Display y-axis ticks Boolean value Yes/No No
-[no]sequence boolean Display the sequence on the graph Boolean value Yes/No Yes
-window integer Sequence display window size Any integer value 40
-bases string Base graphs to be displayed Any string, matching regular expression /[GATC]+/ GATC
Advanced (Unprompted) qualifiers
-separate boolean Separate the trace graphs for the 4 bases Boolean value Yes/No No
Associated qualifiers
"-outseq" associated seqout qualifiers
-osformat2
-osformat_outseq		 string Output seq format Any string  
-osextension2
-osextension_outseq		 string File name extension Any string  
-osname2
-osname_outseq		 string Base file name Any string  
-osdirectory2
-osdirectory_outseq		 string Output directory Any string  
-osdbname2
-osdbname_outseq		 string Database name to add Any string  
-ossingle2
-ossingle_outseq		 boolean Separate file for each entry Boolean value Yes/No N
-oufo2
-oufo_outseq		 string UFO features Any string  
-offormat2
-offormat_outseq		 string Features format Any string  
-ofname2
-ofname_outseq		 string Features file name Any string  
-ofdirectory2
-ofdirectory_outseq		 string Output directory Any string  
"-graph" associated xygraph qualifiers
-gprompt boolean Graph prompting Boolean value Yes/No N
-gdesc string Graph description Any string  
-gtitle string Graph title Any string  
-gsubtitle string Graph subtitle Any string  
-gxtitle string Graph x axis title Any string Residue Position
-gytitle string Graph y axis title Any string  
-goutfile string Output file for non interactive displays Any string  
-gdirectory string Output directory Any string  
General qualifiers
-auto boolean Turn off prompts Boolean value Yes/No N
-stdout boolean Write first file to standard output Boolean value Yes/No N
-filter boolean Read first file from standard input, write first file to standard output Boolean value Yes/No N
-options boolean Prompt for standard and additional values Boolean value Yes/No N
-debug boolean Write debug output to program.dbg Boolean value Yes/No N
-verbose boolean Report some/full command line options Boolean value Yes/No Y
-help boolean Report command line options and exit. More information on associated and general qualifiers can be found with -help -verbose Boolean value Yes/No N
-warning boolean Report warnings Boolean value Yes/No Y
-error boolean Report errors Boolean value Yes/No Y
-fatal boolean Report fatal errors Boolean value Yes/No Y
-die boolean Report dying program messages Boolean value Yes/No Y
-version boolean Report version number and exit Boolean value Yes/No N

Input file format

This reads in a standard ABI trace file.

Input files for usage example

File: abiview.abi

This file contains non-printing characters and so cannot be displayed here.

File: abiview.abi

This file contains non-printing characters and so cannot be displayed here.

Output file format

It outputs a file holding a normal nucleotide sequence.

Output files for usage example

File: abiview.fasta

>abiview
GNNNNNNNNNGNGNNGGGGTTTNANNNTNNNAGAACCCCCCTTNGAAAANNNCCACCCCA
NNATAGTNGTANGAATAGTNCCCAGGCCANGCCTATCTGTGATGATTACATAGGCTAACA
CATGACAAACATTTAAAAACACTAAACAATTGTTATTTATTCTTTGTTCCTATAAACCAC
ACCCATTAAGCCCTTACTATATATAAGAGTTTTCAAGCCAAGAACCTGCTGCTTGGGAGG
CTGATGCAGGAGAATTGCCAAGTACAAACCCTGCCTGGACTGTAAAGTGAAACCAAGGCT
AGTTGTCTCACAATAAAAGATGAAGGGCAAGTGGGATCAATGCATAAAGGAGCTTGTGCC
CAAGCCTGTTAGCCTTAGTTCAATTCCTGAGTACCATGAAAAGGTAGAAGGAGAGAAATG
ATTTGGTACAATTTTTCTCTGTGCTGTGACACAGTACCACCCTCCTACTAATAACAAATA
AAATAATGTTTAAAACAAAATAAAATAAAAATGGACTGGGATGTAGCACAATGGTAGGGT
ACTTGCATAGCATGTACAAGGACCTGATTTCAATCCCCTGTGATAAAAGAAAATAAGGAA
GGGAGGAAGCGTTAGGAGGAAAAATGGAATACAGAAGACACAGTGCATGGGAAGGATATG
TATGTTATGAACACCAGAAATTCACTTGAAAATGAGTAAAATTTTTTTATTATTATATCA
TTATTATTGGGGGGGATGTGGGCGGGGCTTGCAGAGGTATCTTTTAGAGGANGATCATTT
TCCGGTTGTTGAGCAGGGCTCTGTTATGTAGGATATCTCAGANTAACAGACCCCAGGT

Graphics File: abiview.ps

[abiview results]

The horizontal scale of the output image labelled 'Residue Position' is only a very approximate indication of the spacing of residues in the image. The real residue spacing is variable, as it relies on the speed with which the oligo-nucleotides are eluted in the ABI sequencer. Do not be surprised to see the nucleotide signals spaced at a much greater distance than the horizontal scale might suggest.

Data files

None.

Notes

An ABI file (*.abi) contains sequence trace data and base calls from a run of an ABI nucleotide sequencer machine. A trace data file is what you get back from having some DNA sequenced, for example, by a 3730XL sequencer. The files are in "binary" format and so cannot be viewed directly on screen. To inspect the sequencing data you must use a trace viewer such as abiview. Another good trace viewer is FinchTV (http://www.geospiza.com/finchtv/). It is a stand-alone program and is freely available.

References

None.

Warnings

None.

Diagnostic Error Messages

None.

Exit status

It always exits with status 0.

Known bugs

None.

See also

Program name Description
cirdna Draw circular map of DNA constructs
coderet Extract CDS, mRNA and translations from feature tables
entret Retrieve sequence entries from flatfile databases and files
extractalign Extract regions from a sequence alignment
iep Calculate the isoelectric point of proteins
infoalign Display basic information about a multiple sequence alignment
infoseq Display basic information about sequences
lindna Draw linear maps of DNA constructs
pepinfo Plot amino acid properties of a protein sequence in parallel
pepnet Draw a helical net for a protein sequence
pepwheel Draw a helical wheel diagram for a protein sequence
plotorf Plot potential open reading frames in a nucleotide sequence
prettyplot Draw a sequence alignment with pretty formatting
prettyseq Write a nucleotide sequence and its translation to file
refseqget Get reference sequence
remap Display restriction enzyme binding sites in a nucleotide sequence
seqxref Retrieve all database cross-references for a sequence entry
seqxrefget Retrieve all cross-referenced data for a sequence entry
showalign Display a multiple sequence alignment in pretty format
showfeat Display features of a sequence in pretty format
showpep Display protein sequences with features in pretty format
sixpack Display a DNA sequence with 6-frame translation and ORFs
variationget Get sequence variations
whichdb Search all sequence databases for an entry and retrieve it

Author(s)

Tim Carver formerly at:
MRC Rosalind Franklin Centre for Genomics Research Wellcome Trust Genome Campus, Hinxton, Cambridge, CB10 1SB, UK

Please report all bugs to the EMBOSS bug team (emboss-bug © emboss.open-bio.org) not to the original author.

History

Written (January 2001) - Tim Carver

Target users

This program is intended to be used by everyone and everything, from naive users to embedded scripts.

Comments

None