|
|
seqretsplit |
Its main use is therefore to split a file containing multiple sequences into many files, each containing one sequence.
The names of the files it creates are derived from the ID name of the sequence, followed by an extension denoting the format of the sequence. You have no control over the names of the files it writes out.
For example, if the files embl:hsfa11* are read in and the output is specified as wibble.seq, then the following files are expected to be created:
hsfa110.fasta hsfa111.fasta hsfa112.fasta hsfa113.fasta hsfa114.fasta
(No file wibble.seq is created.)
Why would you want to split a multiple sequence file into many individual files?
EMBOSS programs can read in many sequences from one file where this is sensible. Sometimes EMBOSS programs can only read in one sequence at a time because that is the sensible way to do things, but your sequence is one sequence of many in a file. You can specify that sequence using the USA filename:sequenceID, but you may still feel more comfortable splitting your sequences up into many files first.
Many non-EMBOSS programs will also have restrictions on whether they can read in multiple sequence files or not.
% seqretsplit tembl:hsfa* Reads and writes (returns) sequences in individual files output sequence(s) [hsfau.fasta]: |
Go to the input files for this example
Go to the output files for this example
The specification of the output file is not used in this case.
At some point this ought to change and you will not be prompted for the output file at all.
Standard (Mandatory) qualifiers:
[-sequence] seqall (Gapped) sequence(s) filename and optional
format, or reference (input USA)
[-outseq] seqoutall [
|
| Standard (Mandatory) qualifiers | Allowed values | Default | |
|---|---|---|---|
| [-sequence] (Parameter 1) |
(Gapped) sequence(s) filename and optional format, or reference (input USA) | Readable sequence(s) | Required |
| [-outseq] (Parameter 2) |
Sequence set(s) filename and optional format (output USA) | Writeable sequence(s) | <*>.format |
| Additional (Optional) qualifiers | Allowed values | Default | |
| (none) | |||
| Advanced (Unprompted) qualifiers | Allowed values | Default | |
| -feature | Use feature information | Boolean value Yes/No | No |
| -firstonly | Read one sequence and stop | Boolean value Yes/No | No |
>HSFAU X65923.1 H.sapiens fau mRNA ttcctctttctcgactccatcttcgcggtagctgggaccgccgttcagtcgccaatatgc agctctttgtccgcgcccaggagctacacaccttcgaggtgaccggccaggaaacggtcg cccagatcaaggctcatgtagcctcactggagggcattgccccggaagatcaagtcgtgc tcctggcaggcgcgcccctggaggatgaggccactctgggccagtgcggggtggaggccc tgactaccctggaagtagcaggccgcatgcttggaggtaaagttcatggttccctggccc gtgctggaaaagtgagaggtcagactcctaaggtggccaaacaggagaagaagaagaaga agacaggtcgggctaagcggcggatgcagtacaaccggcgctttgtcaacgttgtgccca cctttggcaagaagaagggccccaatgccaactcttaagtcttttgtaattctggctttc tctaataaaaaagccacttagttcagtcaaaaaaaaaa |
>HSFAU1 X65921.1 H.sapiens fau 1 gene ctaccattttccctctcgattctatatgtacactcgggacaagttctcctgatcgaaaac ggcaaaactaaggccccaagtaggaatgccttagttttcggggttaacaatgattaacac tgagcctcacacccacgcgatgccctcagctcctcgctcagcgctctcaccaacagccgt agcccgcagccccgctggacaccggttctccatccccgcagcgtagcccggaacatggta gctgccatctttacctgctacgccagccttctgtgcgcgcaactgtctggtcccgccccg tcctgcgcgagctgctgcccaggcaggttcgccggtgcgagcgtaaaggggcggagctag gactgccttgggcggtacaaatagcagggaaccgcgcggtcgctcagcagtgacgtgaca cgcagcccacggtctgtactgacgcgccctcgcttcttcctctttctcgactccatcttc gcggtagctgggaccgccgttcaggtaagaatggggccttggctggatccgaagggcttg tagcaggttggctgcggggtcagaaggcgcggggggaaccgaagaacggggcctgctccg tggccctgctccagtccctatccgaactccttgggaggcactggccttccgcacgtgagc cgccgcgaccaccatcccgtcgcgatcgtttctggaccgctttccactcccaaatctcct ttatcccagagcatttcttggcttctcttacaagccgtcttttctttactcagtcgccaa tatgcagctctttgtccgcgcccaggagctacacaccttcgaggtgaccggccaggaaac ggtcgcccagatcaaggtaaggctgcttggtgcgccctgggttccattttcttgtgctct tcactctcgcggcccgagggaacgcttacgagccttatctttccctgtaggctcatgtag cctcactggagggcattgccccggaagatcaagtcgtgctcctggcaggcgcgcccctgg aggatgaggccactctgggccagtgcggggtggaggccctgactaccctggaagtagcag gccgcatgcttggaggtgagtgagagaggaatgttctttgaagtaccggtaagcgtctag tgagtgtggggtgcatagtcctgacagctgagtgtcacacctatggtaatagagtacttc tcactgtcttcagttcagagtgattcttcctgtttacatccctcatgttgaacacagacg tccatgggagactgagccagagtgtagttgtatttcagtcacatcacgagatcctagtct ggttatcagcttccacactaaaaattaggtcagaccaggccccaaagtgctctataaatt agaagctggaagatcctgaaatgaaacttaagatttcaaggtcaaatatctgcaactttg ttctcattacctattgggcgcagcttctctttaaaggcttgaattgagaaaagaggggtt ctgctgggtggcaccttcttgctcttacctgctggtgccttcctttcccactacaggtaa agtccatggttccctggcccgtgctggaaaagtgagaggtcagactcctaaggtgagtga gagtattagtggtcatggtgttaggactttttttcctttcacagctaaaccaagtccctg ggctcttactcggtttgccttctccctccctggagatgagcctgagggaagggatgctag gtgtggaagacaggaaccagggcctgattaaccttcccttctccaggtggccaaacagga gaagaagaagaagaagacaggtcgggctaagcggcggatgcagtacaaccggcgctttgt caacgttgtgcccacctttggcaagaagaagggccccaatgccaactcttaagtcttttg taattctggctttctctaataaaaaagccacttagttcagtcatcgcattgtttcatctt tacttgcaaggcctcagggagaggtgtgcttctcgg |
One file for each input sequence is written out.
The names of the files it creates are derived from the ID name of the sequence, followed by an extension denoting the format of the sequence. You have no control over the names of the files it writes out.
For example, if the files embl:hsfa11* are read in and the output is specified as wibble.seq, then the following files are expected to be created:
hsfa110.fasta hsfa111.fasta hsfa112.fasta hsfa113.fasta hsfa114.fasta
(No file wibble.seq is created.)
This isa side effect of the waysequence output works in EMBOSS. Writing multiple sequences to separate files (the -ossingle qualifier) does this, and seqretsplit has set it automatically on.
| Program name | Description |
|---|---|
| biosed | Replace or delete sequence sections |
| codcopy | Reads and writes a codon usage table |
| cutseq | Removes a specified section from a sequence |
| degapseq | Removes gap characters from sequences |
| descseq | Alter the name or description of a sequence |
| entret | Reads and writes (returns) flatfile entries |
| extractalign | Extract regions from a sequence alignment |
| extractfeat | Extract features from a sequence |
| extractseq | Extract regions from a sequence |
| listor | Write a list file of the logical OR of two sets of sequences |
| makenucseq | Creates random nucleotide sequences |
| makeprotseq | Creates random protein sequences |
| maskfeat | Mask off features of a sequence |
| maskseq | Mask off regions of a sequence |
| newseq | Type in a short new sequence |
| noreturn | Removes carriage return from ASCII files |
| notseq | Exclude a set of sequences and write out the remaining ones |
| nthseq | Writes one sequence from a multiple set of sequences |
| pasteseq | Insert one sequence into another |
| revseq | Reverse and complement a sequence |
| seqret | Reads and writes (returns) sequences |
| skipseq | Reads and writes (returns) sequences, skipping first few |
| splitter | Split a sequence into (overlapping) smaller sequences |
| trimest | Trim poly-A tails off EST sequences |
| trimseq | Trim ambiguous bits off the ends of sequences |
| union | Reads sequence fragments and builds one sequence |
| vectorstrip | Strips out DNA between a pair of vector sequences |
| yank | Reads a sequence range, appends the full USA to a list file |
At some point this ought to change and you will not be prompted for the output file at all.