|
|
abiview |
The data for each nucleotide is plotted and the assigned nucleotide (G, A, T, C or N) in the ABI file is overlayed on the graphs.
It also writes out the sequence to an output sequence file.
% abiview -graph cps Reads ABI file and display the trace ABI sequencing trace file: abiview.abi nucleotide output sequence [abiview.fasta]: Created abiview.ps |
Go to the input files for this example
Go to the output files for this example
Standard (Mandatory) qualifiers: [-infile] infile ABI sequencing trace file [-outseq] seqout [ |
| Standard (Mandatory) qualifiers | Allowed values | Default | |
|---|---|---|---|
| [-infile] (Parameter 1) |
ABI sequencing trace file | Input file | Required |
| [-outseq] (Parameter 2) |
Nucleotide sequence filename and optional format (output USA) | Writeable sequence | <*>.format |
| -graph | Graph type | EMBOSS has a list of known devices, including ps, hpgl, hp7470, hp7580, meta, cps, x11, tekt, tek, none, data, xterm, png | EMBOSS_GRAPHICS value, or x11 |
| Additional (Optional) qualifiers | Allowed values | Default | |
| -startbase | First base to report or display | Integer 0 or more | 0 |
| -endbase | Last sequence base to report or display. If the default is set to zero then the value of this is taken as the maximum number of bases. | Any integer value | 0 |
| -yticks | Display y-axis ticks | Boolean value Yes/No | No |
| -[no]sequence | Display the sequence on the graph | Boolean value Yes/No | Yes |
| -window | Sequence display window size | Any integer value | 40 |
| -bases | Base graphs to be displayed | Any string is accepted, matching regular expression /[GATC]+/ | GATC |
| Advanced (Unprompted) qualifiers | Allowed values | Default | |
| -separate | Separate the trace graphs for the 4 bases | Boolean value Yes/No | No |
This file contains non-printing characters and so cannot be displayed here.
This file contains non-printing characters and so cannot be displayed here.
>../../data/abiview.abi GNNNNNNNNNGNGNNGGGGTTTNANNNTNNNAGAACCCCCCTTNGAAAANNNCCACCCCA NNATAGTNGTANGAATAGTNCCCAGGCCANGCCTATCTGTGATGATTACATAGGCTAACA CATGACAAACATTTAAAAACACTAAACAATTGTTATTTATTCTTTGTTCCTATAAACCAC ACCCATTAAGCCCTTACTATATATAAGAGTTTTCAAGCCAAGAACCTGCTGCTTGGGAGG CTGATGCAGGAGAATTGCCAAGTACAAACCCTGCCTGGACTGTAAAGTGAAACCAAGGCT AGTTGTCTCACAATAAAAGATGAAGGGCAAGTGGGATCAATGCATAAAGGAGCTTGTGCC CAAGCCTGTTAGCCTTAGTTCAATTCCTGAGTACCATGAAAAGGTAGAAGGAGAGAAATG ATTTGGTACAATTTTTCTCTGTGCTGTGACACAGTACCACCCTCCTACTAATAACAAATA AAATAATGTTTAAAACAAAATAAAATAAAAATGGACTGGGATGTAGCACAATGGTAGGGT ACTTGCATAGCATGTACAAGGACCTGATTTCAATCCCCTGTGATAAAAGAAAATAAGGAA GGGAGGAAGCGTTAGGAGGAAAAATGGAATACAGAAGACACAGTGCATGGGAAGGATATG TATGTTATGAACACCAGAAATTCACTTGAAAATGAGTAAAATTTTTTTATTATTATATCA TTATTATTGGGGGGGATGTGGGCGGGGCTTGCAGAGGTATCTTTTAGAGGANGATCATTT TCCGGTTGTTGAGCAGGGCTCTGTTATGTAGGATATCTCAGANTAACAGACCCCAGGT |
The horizontal scale of the output image labelled 'Residue Position' is only a very approximate indication of the spacing of residues in the image. The real residue spacing is variable, as it relies on the speed with which the oligo-nucleotides are eluted in the ABI sequencer. Do not be surprised to see the nucleotide signals spaced at a much greater distance than the horizontal scale might suggest.
| Program name | Description |
|---|---|
| cirdna | Draws circular maps of DNA constructs |
| lindna | Draws linear maps of DNA constructs |
| pepnet | Displays proteins as a helical net |
| pepwheel | Shows protein sequences as helices |
| prettyplot | Displays aligned sequences, with colouring and boxing |
| prettyseq | Output sequence with translated ranges |
| remap | Display sequence with restriction sites, translation etc |
| seealso | Finds programs sharing group names |
| showalign | Displays a multiple sequence alignment |
| showdb | Displays information on the currently available databases |
| showfeat | Show features of a sequence |
| showseq | Display a sequence with features, translation etc |
| sixpack | Display a DNA sequence with 6-frame translation and ORFs |
| textsearch | Search sequence documentation. Slow, use SRS and Entrez! |